Peritrich nuclear code
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.[1]
The code (30)
AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (30) | Standard code (1) |
|---|---|---|---|
| TAA | UAA | Glu (E) | Ter (*) |
| TAG | UAG | Glu (E) | Ter (*) |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[2]
- ↑ Sánchez-Silva, Rocı́o; Villalobo, Eduardo; Morin, Loı̈c; Torres, Antonio (2003). "A New Noncanonical Nuclear Genetic Code". Current Biology. 13 (5): 442–447. doi:10.1016/s0960-9822(03)00126-x.
- ↑ The Genetic Codes (update: Nov. 18, 2016)
This article is issued from
Wikipedia.
The text is licensed under Creative Commons - Attribution - Sharealike.
Additional terms may apply for the media files.