Haplogroup R2

Haplogroup R2
Possible time of origin 27,000 BP[1]
Possible place of origin South Asia or Central Asia[1]
Ancestor Haplogroup R
Descendants R2a (M124);
R2b (FGC21706)
Defining mutations M479

Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).

R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels in North Pakistan. However, it also appears to have long been present at low levels in the Caucasus, Iran, Anatolia and Europe.

It has two primary branches: R2a (M124) and R2b (R-FGC21706)

Structure


Source: ISOGG 2017.[1]

Geographical distribution

Frequency of R2(xR2a) (M479+, M124-)
Count Sample size Frequency (%)
Lisbon, Portugal 1 100 1.0
Seville, Andalusia, Spain 1 127 0.8
Bashkirs, Bashkortostan, Russia 1 39 2.6
Northern Italy 1 124 0.8
South Ossetia 1 23 4.3
Burusho, Gilgit-Baltistan, Pakistan 7 19 36.8[2]
North Pakistan 6 85 7.1

Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).

In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)

In 2013, R2(xR2a) was found in five out of 19 males from the Burusho minority of North Pakistan.[2]

R2a (R-M124)

Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249,[1] and is mainly found in South Asia, with lower frequencies in Central Asia and the Caucasus.

Phylogenetic tree

M479


R2*


M124

 R2a


 FGC21706

 R2b



Description of the SNP M479

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

Notes

  1. 1 2 3 4 ISOGG, 2017, Y-DNA Haplogroup R and its Subclades – 2017 (17 June 2017).
  2. 1 2 Julie Di Cristofaro , Erwan Pennarun , Stéphane Mazières, Natalie M. Myres, Alice A. Lin, Shah Aga Temori, Mait Metspalu, Ene Metspalu, Michael Witzel, Roy J. King, Peter A. Underhill, Richard Villems & Jacques Chiaroni , 2013, “Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge”, ‘’PLoS One’’ (October 18). (17 June 2017.)

See also

Y-DNA R-M207 subclades

Y-DNA backbone tree

Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1 [χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1  F2  F3  GHIJK
G HIJK
IJK H
IJ   K
I J     LT [χ 5]  K2
L     T [χ 6] K2a [χ 7] K2b [χ 8]   K2c   K2d  K2e [χ 9]  
K2a1                    K2b1 [χ 10]    P [χ 11]
NO    S [χ 12]  M [χ 13]    P1     P2
NO1    Q   R
N O
  1. ↑ Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. PMID 24166809. doi:10.1002/humu.22468.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Between 2002 and 2008, Haplogroup T (M184) was known as "Haplogroup K2" – that name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
  7. ↑ Haplogroup K2a (M2308) and the new subclade K2a1 (M2313) were separated from Haplogroup NO (F549) in 2016. (This followed the publication of: Poznik GD, Xue Y, Mendez FL, et al. (2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–9. PMC 4884158 Freely accessible. PMID 27111036. doi:10.1038/ng.3559. In the past, other haplogroups, including NO1 (M214) and K2e had also been identified with the name "K2a".
  8. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  9. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a).
  10. ↑ Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure.
  11. ↑ Haplogroup P (P295) is also klnown as K2b2.
  12. ↑ Haplogroup S, as of 2017, is also known as K2b1a. (Previously the name Haplogroup S was assigned to K2b1a4.)
  13. ↑ Haplogroup M, as of 2017, is also known as K2b1b. (Previously the name Haplogroup M was assigned to K2b1d.)
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.