Haplogroup R-M479

Haplogroup R-M479
Possible time of origin 12,000 ybp
Possible place of origin South Asia or Central Asia
Ancestor R-M207
Descendants R-M124
Defining mutations M479
Highest frequencies n/a

Haplogroup R-M479 is a Y-chromosome haplogroup characterized by genetic marker M479.

Subclades

Haplogroup R-M479
Paragroup R-M479*

  Haplogroup R-M124

 



Paragroup R-M479*

Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.

Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.

Frequency of Paragroup R-M479* (M479+, M124-)
Count Sample size R-M479* Frequency
Portugal, Lisbon 1 100 0.010
Andalusia, Sevilla 1 127 0.008
Bashkirs (Bashkortostan, Russia) 1 39 0.026
Italy North 1 124 0.008
Ossetian South (South Caucasus) 1 23 0.043
Pakistan North 6 85 0.071

Haplogroup R-M124

Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.

Position on the ISOGG tree and related SNPs

Haplogroup R-M479 is a subgroup of Haplogroup R (M207):

Description of the M479 SNP

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

Notes

    See also

    Y-DNA R-M207 subclades

    • R-L21
    • R-L295
    • R-M124
    • R-M167
    • R-M17
    • R-M173
    • R-M207
    • R-M342
    • R-M420
    • R-M479
    • R-U106

    Y-DNA backbone tree

    Evolutionary tree of human Y-chromosome DNA (Y-DNA) haplogroups
    MRC Y-ancestor
    A00 A0'1'2'3'4
    A0 A1'2'3'4
    A1 A2'3'4
    A2'3 A4=BCDEF
    A2 A3 B CDEF
    DE CF
    D E C F
    GHIJKLT
    G HIJKLT
    H IJKLT
    IJ KLT (K)
    I J LT(K1) K (K2)
    L T MPS (K2b) X (K2a)
    MS P NO
    M S QR N O
    Q R
    1. ↑ van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809.

    External links