Subgenomic mRNA

From Wikipedia, the free encyclopedia

Subgenomic mRNA's are essentially smaller sections of the original transcribed template strand. During transcription, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the 5' end of the template, creating a 3' tail for the newly created strand. As a result, the newly created strand will have similar 5' ends to varying degrees with the original template (depending on when the transcription began the jump) and similar 3' ends to the template[1].

The result is many different proteins created from the different lengths of mRNA created from the same strand with similar 5' ends (to varying degrees) and same 3' ends. The similar 5' sections on the newly created strand is a result of the same section being copied from the template strand, and this section on the template strand is referred to as the "nested set"[2].

GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original Strand

GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACAAAAAAAAA      |
GCCGCCCCGTATCGATCGTAGCGCACAAAAAAAAA                 | = Subgenomic mRNA
GCCGCCCCGTATAAAAAAAAA                               |

GCCGCCCCGTAT = Nested Set

[edit] Examples

This complex method of transcription is generally restricted to viruses, especially those of the single-stranded, positive-sense RNA or Class IV viruses using the Baltimore Classification System. Its use is primarily used for compacting more genetic information into a shorter amount of genetic material[3].

[edit] Literature

  1. ^ Wu B, White KA. "Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights." EMBO J. 2007 Nov 22
  2. ^ Le TM, Wong HH, Tay FP, Fang S, Keng CT, Tan YJ, Liu DX. "Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus." FEBS J. 2007 Aug;274(16):4211-22. Epub 2007 Jul 20.
  3. ^ Xu W, White KA. "Subgenomic mRNA transcription in an aureusvirus: Down-regulation of transcription and evolution of regulatory RNA elements." Virology. 2007 Nov 5

please correct the references; it is 26 not 22 volume the first one is: Wu, Baodong & White, K.A. 2007. Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights. The EMBO Journal. 26, 5120–5130