Talk:Shotgun sequencing
From Wikipedia, the free encyclopedia
 |
This article is within the scope of the Molecular and Cellular Biology WikiProject. To participate, visit the WikiProject for more information. The WikiProject's current monthly collaboration is focused on improving Restriction enzyme. |
||
| Start | This article has been rated as Start-Class on the assessment scale. |
||
| Mid | This article is on a subject of Mid-importance within molecular and cellular biology. | ||
|
Article Grading: The article has been rated for quality and/or importance but has no comments yet. If appropriate, please review the article and then leave comments here to identify the strengths and weaknesses of the article and what work it will need. |
|||
Contents |
[edit] Name origin
According to the book Genome War (specific reference needed), the technique gets its name from the dispersive mechanism used break DNA strands into small pieces. I am not an expert, but someone who is should either correct this or offer an alternate reference.
David Hollman (talk) 22:20, 28 April 2008 (UTC)
[edit] Meaningless example
I have tabluated the strands so that the sequences line up. You should notice that every sequence is now the same.
I'm not a biologist of bioinformatician. Someone needs to fix this, because it's either wrong, unexplained, or both. I'm simply not knowledgeable here.
Josephholsten (talk) —Preceding comment was added at 02:14, 24 November 2007 (UTC)
Deleted
- The DNA is first cut into small pieces by restriction enzymes.
because I feel certain that's wrong. If the DNA is cut, it's more likely fractionated, because it's important to get random samples. The article as a whole is pretty vague and somewhat suspect, but unfortunately I don't know that much about the details either...
Zashaw 23:11, 21 Jun 2004 (UTC)
[edit] So how do you do the sequencing then?
There's something odd about this article: Sequencing lists this as a method used to sequence DNA, but this article says "...and then these clones are sequenced". How can the last step of sequencing be sequencing? Does it mean, "these clones are sequenced using sequencing method X"? Of the three methods mentioned under sequencing, only Chain termination method seems to actually be a method of sequencing, the other two just refer back to some unexplained "sequencing" process. Anyone care to clarify? - IMSoP 00:19, 22 Oct 2004 (UTC)
- Fixed (I hope I got it right). - IMSoP 21:21, 14 Nov 2004 (UTC)
[edit] Whole genome shotgun sequencing
What is the difference between this and Whole genome shotgun sequencing? Jmeppley 21:26, 26 May 2005 (UTC)
- The two articles should really be merged. An alternative to WGS is the BAC-based method...the difference is in how careful you are about splitting up the original DNA into pieces to be sequenced. But the basic idea of assembly is the same with either method, and the term "shotgun" is in contrast to chromosome walking. The simplified information presently in this article applies to both WGS and BAC approaches. (see for example [1]) --Mike Lin 08:54, 13 October 2005 (UTC)
RESOLVED Josephholsten (talk) 02:18, 24 November 2007 (UTC)
[edit] Double Barrel Shotgun Sequencing
Some information about Double Barrel Shotgun Sequencing would be nice. T_P
reply (to Double Barrel Shotgun Sequencing": LOL man I'm a grad school student reading up about this stuff for a bioinformatics project and this really made my day!! haha -Kris
[edit] External Link to Scientist Article
Why is there a link to material that is not freely available? I don't think we should link to articles that require registration. neffk 17:36, 9 August 2006 (UTC)
Most books need to be bought, or require membership at a library which has paid for access to the material. Because it is unreasonable to exclude books from citations, and that digital content behind pay-walls have equivalent accessibility, we should not discriminate against such content. For example, Nature and Science are certainly not free, but scientific articles demand citing them because of their quality. Josephholsten (talk) 02:26, 24 November 2007 (UTC)
[edit] Craig`s argument is that SPEED MATTERS
But that`s just really not true, as we know for a long time that even so much as one nucleotide pair can have a dramatic change, in fact a methylation alone can have an enourmous effect. So even the human genome project is barely enough in terms of quality. Whole genome shotgun sequencing is a top technology, no question about that but only to provide a first glimpse, similar to a page being scanned and getting a thumbail before the actual scanning progcess. In the future as software and our understanding of biology becomes better all this might change in favor of shotg. seq. but until then it remains as i pointed out.Slicky 12:26, 24 August 2006 (UTC)
[edit] Please provide reference
Please provide a reference for "For example, to complete the Human Genome Project, most of the human genome was sequenced at 12X or greater coverage; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the (euchromatic) human genome.". Thank you. —The preceding unsigned comment was added by 130.212.235.23 (talk) 21:29, 20 March 2007 (UTC).
- The answer to your question is present in the question itself..."most of the human genome was sequenced at 12X." Most of the sections that aren't complete have actually been sequenced but due to the highly repetitive nature of the repeats it is difficult to determine exactly how many repeats are present.
- For example, suppose you sequence two fragments
- Frag 1: AGCGATTAATTAATTAATTAATTAATT
- Frag 2: AATTAATTAATTAATTAATTGCGCCAG
- In this case, it's very difficult to know how many repeats of AATT are between the two unique sequences at the ends. This isn't an easy problem to solve because chain termination sequencing can only get about 300-1000 bases accurately and it's therefore difficult to bracket repetitive sequences with unique sequences.Mrestko 02:26, 13 April 2007 (UTC)
