Haplogroup Q (Y-DNA)

From Wikipedia, the free encyclopedia

Haplogroup Q
Time of origin 15,000 to 20,000 BC
Place of origin Ural or Siberia
Ancestor P
Defining mutations M242
Typical members Selkups (~70%) and Kets (~95%)

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.

This haplogroup contains the patrilineal ancestors of many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[1] This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

Contents

[edit] Origins

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 15,000 years ago. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 SNP.

[edit] Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc

[edit] Distribution

In the Old World the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the West, Iran in the South and Mongolia in the East. There is also a rough correlation between the Turkic-speaking peoples of Central Eurasia and Q. The frequency of Q in Norway and Mongolia is about 4% while in the Iranian cities of Shiraz and Esfahan, the frequency runs between 6% and 8%; Iranian samples of haplogroup Q belong almost exclusively to the M25 defined subclade. In the middle of this triangle, in Uzbekistan and Turkmenistan, the frequency of Q runs between 10% and 14%. Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.

[edit] Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in Indian subcontinent, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent.

[edit] Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree:

[edit] References

  1. ^ High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, Stephen L. Zegura, Tatiana M. Karafet et al., 2003
  2. ^ Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture," Nature 431, 302-305 (16 September 2004)
  3. ^ Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
  4. ^ "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas," Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003

[edit] External links

[edit] See also

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups, famous haplotypes)
most recent common Y-ancestor
|
A BT
B CT
DE CF
D E C F
G H IJ K
I J L M NO P S T
N O Q R
Languages