Haplogroup J (Y-DNA)

From Wikipedia, the free encyclopedia

Haplogroup J
Time of origin 30,000 years BP
Place of origin Near East
Ancestor IJ
Defining mutations M304

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.

Contents

[edit] Origins

Haplogroup J is believed to have arisen 31,700 years ago (plus or minus 12,800 years) in the Near East (Semino et al. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J are descendants of Haplogroup IJ (S2, S22). Along with haplogroups G, H and K, haplogroup IJ is in turn derived from Haplogroup F. The main current subgroups J1 and J2, which now account between them for almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.


Haplogroup J is mostly found in South-East Europe, especially in central and southern Italy, Greece and Romania. It is also common in France, and in the Middle East. It is related to the Ancient Romans, Greeks and Phoenicians (J2), as well as the Arabs and Jews (J1). Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia and southern Italy, and are associated with the Ancient Greeks.

[edit] Subclades

The subclades of Haplogroup J with their defining mutation, according to the 2006 ISOGG tree:

  • J (12f2.1, M304, S6, S34, S35)
    • J*
    • J1 (M267) Typical of populations of Dagestan, Mesopotamia, the Levant, Arabia, and Semitic-speaking populations of North Africa and Northeast Africa, with a moderate distribution throughout Southwest Asia
      • J1*
      • J1a (M62)
      • J1b (M365)
      • J1c (M367, M368)
      • J1d (M369)
      • J1e (M390)
    • J2 (M172) Typical of populations of Southern Europe, Turkey, northern Iraq, Iran, and the Caucasus, with a moderate distribution throughout Southwest Asia, Central Asia, South Asia, and North Africa
      • J2*
      • J2a (M410)
        • J2a*
        • J2a1 (DYS413≤18)
          • J2a1*
          • J2a1a (M47, M322)
          • J2a1b (M67 (S51))
            • J2a1b*
            • J2a1b1 (M92, M260)
              • J2a1b1*
              • J2a1b1a (M327)
            • J2a1b2 (M163, M166)
          • J2a1c (M68)
          • J2a1d (M137)
          • J2a1e (M158)
          • J2a1f (M289)
          • J2a1g (M318)
          • J2a1h (M319)
          • J2a1i (M339)
          • J2a1j (M419)
          • J2a1k (DYS445≤7)
        • J2a2 (M340)
      • J2b (M12, M314, M221)
        • J2b*
        • J2b1 (M102) Mainly found in the Balkans, Greece, and Italy (possibly from Ancient Greeks)
          • J2b1*
          • J2b1a (M241)
            • J2b1a*
            • J2b1a1 (M99)
            • J2b1a2 (M280)
            • J2b1a3 (M321)
          • J2b1b (M205)

It is subdivided into two subclades: haplogroup J2, defined by the M172 marker, and haplogroup J1, defined by the M267 marker.

[edit] J1

Main article: Haplogroup J1 (Y-DNA)

Haplogroup J1 appears at high frequencies among populations of Southwest Asia, North Africa, and Ethiopia (Thomas et al. 1999). J1 was spread by two temporally distinct migratory episodes, the most recent one probably associated with the diffusion of Muslims from Arabia since the 6th century CE.[2]

Haplogroup J1 is most frequent in Northeast Caucasian populations of Dagestan (Avars 67%, Lezgins 58% (Yunusbaev et al.)) and Arabs of the southern Levant, i.e. Palestinian Arabs (38.4%) (Semino et al.) and Arab Bedouins (62% and 82% in Negev desert Bedouins). It is also very common among other Arabic-speaking populations, such as those of Algeria (35%), Syria (30%), Iraq (33%), the Sinai Peninsula, and the Arabian Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic countries with mainly non-Arabic countries, such as Turkey and Iran, yet it is found at low frequency among the populations of those countries, as well as in Cyprus, Sicily and the Iberian Peninsula. It entered Ethiopia in the Neolithic with the Neolithic Revolution and spread of agriculture, where it is found mainly among Semitic speakers (e.g. Amhara 33.3%). It spread later to North Africa in historic times (as identified by the motif YCAIIa22-YCAIIb22; Algerians 35.0%, Tunisians 30.1%)Romanians(45%)[citation needed] , where it became something like a marker of the Arab expansion in the early medieval period (Semino et al. 2004). Researchers believe that marker DYS388=17 (Y DNA tests for STR - Short Tandem Repeater) is linked with the later expansion of Arabian tribes in the southern Levant and northern Africa (Di Giacomo et al. 2004).

Haplogroup J1 is found almost exclusively among modern populations of the Caucasus, Southwest Asia, North Africa, and the Horn of Africa, essentially delineating the region popularly known as the Middle East and associated with speakers of Semitic languages and Caucasian languages. The distribution of J1 outside of the Middle East may be associated with Arabs and Phoenicians who traded and conquered in Sicily, southern Italy, Spain, Azerbaijan, Turkey, and Pakistan, or with Jews, who have historical origins in the Middle East and speak (or historically spoke) a Semitic language, though typically Haplogroup J2 is more than twice as common among Jews. In Jewish populations overall, J1 constitutes 19.0% of the Ashkenazim results and 11.9% of the Sephardic results (Semino et al. 2004)(Behar et al. 2004). Haplogroup J1 with marker DYS388=13 is a distinctive type found in eastern Anatolia (Cinnioglu et al. 2004).

[edit] J2

Main article: Haplogroup J2 (Y-DNA)

Haplogroup J2 is thought to have originated in Anatolia (Turkey) or northern Mesopotamia and to have subsequently spread to other Middle Eastern areas, Europe, Central Asia, and South Asia. Subclades of Haplogroup J2 are commonly found in Turkey, the Levant, Mesopotamia, the South Caucasus (Georgia, Armenia, Azerbaijan), Iran, Central Asia, and South Asia: for example, Muslim Kurds (28.4%), Central Turks (27.9%), Georgians (26.7%), Iraqis (25.2%), Lebanese (25%), Ashkenazi Jews (23.2%), Sephardi Jews (28.6%), Iranians (23.3%), Tajiks (18.4%), and Pakistanis (14.7%). Haplogroup J2 is also common among Turkic peoples of the North Caucasus, such as Balkars (25%) and Kumyks (25%). J2 is not regularly found in Semitic-speaking populations of Africa, such as the Amhara and Tigrinya in Ethiopia (Semino et al. 2004). However, J2 has been found to encompass several subhaplogroups (22 subhaplogroups, including 5 that have high frequencies) that originated in or expanded into different regions: the Iberian Peninsula, Southern Italy, the Balkans, the Aegean, Anatolia (Turkey and Kurds), the Caucasus (Georgia), and Somalia (Sanchez et al. 2005). Haplogroup J2 used to be considered a genetic marker of Anatolian Neolithic agriculturalists. It is also very frequent in the Balkans (Greeks 20.6%, Albanians 19.6%) and in Iberia (16.7-29.1%). Its frequency rapidly drops in the Carpathian basin (Ukrainians 7.3%, Croatians 6.2%, Hungarians 2.0%) and in Southeastern Iranian-speaking areas (Pashtuns 5.2%, Pamiris 6.1%). A significant presence of J2 (J2b2+J2a) was detected in western and south-western India (the highest being 21% among Dravidian middle castes, followed by upper castes, 18.6%, and lower castes 14%; Sengupta et al. 2006).

[edit] J*(xJ1,J2)

There are also some haplogroup J Y-chromosomes that belong to neither J1 nor J2, and are said to be in paragroup J*(xJ1,J2). This means that haplogroup J* includes all of J except for J1 and J2. However, Y-chromosomes that belong to paragroup J* are extremely rare among human populations of the present day.

[edit] Mutation

The technical details of M304 are:

Nucleotide change: A to C
Position (base pair): 421
Total size (base pairs): 527
Forward 5′→ 3′: caaagtgctgggattacagg
Reverse 5′→ 3′: cttctagcttcatctgcattgt

[edit] Haplotypes

[edit] Modal

DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 12 23 14 10 14 17 11 16 11 13 11 30 17 8 9 11 11 26 14 20 28 13 14 15 16
See also: Y-chromosomal Aaron

[edit] Famous

Matt Lauer belonged to Y-DNA haplogroup J.[1]

[edit] See also

[edit] References

  1. ^ [1], ISOGG

[edit] External links


Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups, famous haplotypes)

most recent common Y-ancestor
|
A BT
B CT
DE CF
D E C F
G H IJ K
I J L M NO P S T
N O Q R