Haplogroup I1 (Y-DNA)

From Wikipedia, the free encyclopedia

In human genetics, Haplogroup I1 is a Y-chromosome haplogroup occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs). It is a subclade of Haplogroup I. Before a reclassification in 2008,^[1] the group was known as Haplogroup I1a.^[2] Many individuals and organizations continue to use the I1a designation.

The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland and more than 50 percent in the province of Satakunta,^[3] around 35 percent in southern Norway, southwestern Sweden especially on the island of Gotland, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic sphere of influence.^[4]

[edit] Origins

For several years the prevailing theory was that during the Last Glacial Maximum (LGM)^[5] the I1 group sought refuge in the Balkans.^[6] For a time, the Ukraine was considered as an alternative. Yet, The Genographic Project claims that the founder of the I1 branch lived on the Iberian Peninsula during the LGM. Some have given southern France and the Italian peninsula as possible sites as well.^[7] Although the locations vary, proponents of the refuge theories do seem to agree on one issue: that the I1 subclade is from 15,000 to 20,000 years old.^[8]

A map of European LGM refuges, including the Balkans, where some believe the ancestors of I1 lived. Approximately 20,000 years ago, much of Europe was covered in ice and permafrost. The theory has been challenged recently by an opposing argument that I1 was not in existence during the LGM.

However, professor Ken Nordtvedt of Montana State University believes that I1 is a more recent group, probably emerging after the LGM.^[9] Other researchers including Peter A. Underhill of the Human Population Genetics Laboratory at Stanford University have since confirmed this hypothesis in independent research.^[10][11] The map to the right showing the expansion of the Germanic tribes from 750 BC to AD 1 also appears to support this concept.

The study of I1, which some had argued was largely ignored by the genetic testing industry in favor of "mega-haplogroups" like R, is in flux. Revisions and updates to previous thinking, primarily published in academic journals, is constant, yet slow, showing an evolution in thought and scientific evidence.^[12]

The expansion of the Germanic tribes 750 BC – AD 1 (after the Penguin Atlas of World History 1988):       Settlements before 750BC       New settlements until 500BC       New settlements until 250BC       New settlements until AD 1

The most recent common ancestor (MRCA) of I1 lived around 6,000 years ago somewhere in the far northern part of Europe, perhaps Denmark, according to Nordtvedt. His descendants are primarily found among the Germanic populations of northern Europe and the bordering Uralic and Celtic populations, although even in traditionally Germanic demographics I1 is overshadowed by the more prevalent Haplogroup R.

When SNPs are unknown or untested and when short tandem repeat (STR) results show eight allele repeats at DNA Y-chromosome Segment (DYS) 455, haplogroup I1 can be predicted correctly with a very high rate of accuracy, 99.3 to 99.8 percent, according to Whit Athey and Vince Vizachero.^[13][14] This is nearly exclusive and ubiquitous to the I1 haplogroup, with very few having seven, nine or otherwise. Furthermore, DYS 462 divides I1 geographically. Nordtvedt considers 12 allele repeats to be more likely Anglo-Saxon and on the southern fringes of the I1 map while 13 signifies more northernly, Nordic origins.^[15] SNP testing is generally not as beneficial as expanded STR results, Nordtvedt has repeatedly argued, at least for I1.

The Great Migration in Europe or Völkerwanderung ("wandering of peoples") during the 1st century occurred in two stages. The Germanic tribes were part of the first wave roughly from AD 300 to 500 during the decline of the Roman Empire. It may have been triggered in part by Hun and Mongol incursions and Turk migrations in central Asia. Later from about 800 to 1100 the three branches of Vikings — Danes, Swedes, and Norwegians — raided and settled large areas of eastern and western Europe, with remote outposts in Iceland and North America.^[16]

In Russia Scandinavian invaders were known as Varangians.^[17] Varangian leader Rurik founded the first Russian state. Although recent genetic studies have identified two major royal lines, R1a and N1c1a,^[18] genetic research shows significant I1 contribution centering on Moscow.^[19]

Goth movement into Poland, the Ukraine, the Crimea and later the Roman Empire also contributed to the dispersion of I1 throughout Europe and may explain its presence in the Balkans.^[20]

Norsemen in the early medieval period who raided and plundered areas in Great Britain and Ireland were generally called Vikings.

[edit] Subclades

Note: the systematic subclade names have changed several times in recent years, and are likely to change again, as new markers are discovered which clarify the sequence of branching of the tree.

• I1 (M253,^[21] M307,^[22] M450, P30, P40, S62, S63, S64, S65, S66, S107, S108, S109, S110, S111.^[23])
  • I1*
  • I1a (M227) formerly I1a1, I1a4
    • I1a*
    • I1a1 (M72) formerly I1a1a, I1a3
  • I1b (M21) formerly I1a2
  • I1c (P109)
  • I1d (P259)

[edit] Distribution

Outside Scandinavia, distribution of Haplogroup I1 is closely correlated with Haplogroup I2a1, but among Scandinavians including both Germanic and Uralic peoples of the region nearly all the Haplogroup I chromosomes are I1. I1 is common in men living near the southern Baltic and North Sea coasts, although successively decreasing the more southerly one goes.

[edit] Britain

See also: Settlement of Great Britain and Ireland

A map of England showing the general locations of the Germanic (Angle, Saxon and Jute) and indigenous (Briton, Hwicca) peoples around the year 600

In the United Kingdom, Scandinavian influence, which Oppenheimer said was stronger than expected in his analysis, could outweigh that of West Germanic peoples. He identified genetic differences between the Saxon and Anglian areas of England, historically referred to as the heptarchy, composed of seven kingdoms, although specific details have not been released publicly. There has been some criticism of Oppenheimer because of this.

Oxford archaeologist David Miles has argued that 80 percent of the genetic makeup of native Britons probably comes from "just a few thousand" nomadic tribesmen who arrived 12,000 years ago, at the end of the Ice Age, probably excluding I1. This suggests later waves of immigration may have been too small to have significantly affected the genetics of the pre-existing population.^[24] Other researchers suggest that between 50 and 100 percent of the indigenous population was wiped out in what has been described as ethnic cleansing.^[25]

Traditionally, areas with a majority Angle influence included the Kingdoms of Nord Angelnen (Northumbria), Ost Angelnen (East Anglia) and Mittlere Angelnen (Mercia) while the Saxon areas were the Kingdoms of Sussex, Essex, and Wessex.^[26] The Kingdom of Kent was considered a place of another Germanic tribe, the Jutes. Oppenheimer suggested that the Anglo-Saxon invasions actually had been predominantly Anglian.^[27]

Simplified map of 2nd to 5th century migrations, showing the Jutes, Saxons and Angles movements into Britain while the Franks overtake northern France during the fall of the Roman Empire. Goth migration from Sweden to large parts of eastern Europe were precursors to invasions of Roman Empire.

Meanwhile, Sykes said that the Anglo-Saxons made a substantial contribution to the genetic makeup of England, but probably less than 20 percent of the total, even in southern England, where raids and settlements were supposedly commonplace. His conclusions, on Britain at least, mirror those of other researchers including Rootsi and Nordtvedt.^[28] A report on the Saxons who were part of the Germanic settlement of Britain during and after the 5th century was issued by University College London in July 2006, with a wide ranging estimate for the total number of settlers varying between 10,000-200,000.^[29]

The Vikings, both Danes and Norwegians, also made a substantial contribution after the Angles, Saxons and Jutes, Sykes said, with concentrations in central, northern, and eastern England, territories of the ancient Danelaw. Sykes said he found evidence of a very heavy Viking contribution in the Orkney and Shetland Islands, near 40 percent. Mitochondrial DNA as well as Y DNA of northern Germanic origin were discovered at substantial rates in all of these areas, showing that the Vikings engaged in large-scale settlement, Sykes explained. However, Nordtvedt has said that separating I1 haplotypes into Viking and non-Viking groups has been impossible thus far.

Genetic evidence of Norman influence in England was extremely small, about two percent according to Sykes, discounting the idea that William the Conquerer, his troops and any settlers disrupted and displaced previous cultures. Some notable British historians and Anglophiles including J. R. R. Tolkien assumed that the Norman invasion of AD 1066 greatly affected the society of the time and that little survived from the "original" Britons. This worldview permeates Tolkien's Lord of the Rings trilogy and other writings, though he focuses on Germanic folktales and legends rather than the Celtic in creating a replacement mythology, albeit fictional. In England from the 5th to 7th centuries the Anglo-Saxons soon developed their own variety as well.

Map of England from the Anglo-Saxon Chronicle

The study of languages and place names provides more supporting evidence. For example, Old English emerged from the Anglo-Frisian dialects brought to Britain by Germanic settlers and perhaps Roman soldiers. The convergence of varying languages lends credence to a diverse genetic pool. Initially, the English language began as a diverse group of dialects reflecting the varied backgrounds of the Anglo-Saxon kingdoms. One of these dialects, Late West Saxon, eventually dominated.

Then two waves of invaders brought new influences. The first was by language speakers of the Scandinavian branch, known as North Germanic. They conquered and colonized parts of Britain in the 8th and 9th centuries. The second was the Normans in the 11th century, who spoke Old French and ultimately developed an English variety called Anglo-Norman. These two invasions caused English to become linguistically "mixed" to some degree. English developed into a "borrowing" language of great flexibility with a large vocabulary.

In England the Viking Age began dramatically on June 8, 793 when Norsemen destroyed the abbey at Lindisfarne, plundering and murdering indiscriminately. An incident four years earlier where three Viking ships were beached in Portland Bay, perhaps on a trading expedition, created some tension, but Lindisfarne was different. The devastation of Northumbria's Holy Island shocked many including the royal Courts of Europe. More than any other single event, the attack on Lindisfarne cast a shadow on the perception of the Vikings for the next twelve centuries.

[edit] France

Some researchers have indicated a belief that the I1 lineage had its roots in northern France, though there is little evidence for this argument.^[30] Family Tree DNA continues to promote this theory.^[31] Genetic remnants remain in northern France, indicating a small influx of I1 men, likely during Viking raids and subsequent settlement.^[32] Subtle increases in I1 haplotypes indicate a modest contribution, perhaps from a combination of the Frankish migration during the last days of the Roman Empire and later Viking incursions. Nordtvedt subscribes to this concept.^[33]

The Franks, from whom France is named and literally meaning "Land of the Franks," were a Germanic tribe first identified in the 3rd century as an ethnic group living north and east of the Lower Rhine. They founded one of the Germanic monarchies which replaced the Western Roman Empire from the 5th century. The Frankish state consolidated its hold over large parts of western Europe by the end of the 8th century. The Carolingian Empire and its successor states were Frankish.

Following the successful example of a Cornish-Viking alliance in 722 at the Battle of Hehil, which helped stop the Anglo-Saxon conquest of Cornwall at the time, the people of Brittany (Bretons) made friendly overtures to the Danish Vikings in an effort to counter Frankish expansionism. In 866 the Vikings and Bretons united to defeat a Frankish army at the Battle of Brissarthe, resulting in formal recognition of Brittany's independence.

The Vikings continued to tactically help their Breton allies by devastating Frankish areas under the Carolingians with pillaging raids. In 885, one of the minor Viking leaders named Rollo helped in the siege of Paris under the command of Danish king Sigfred. When Sigfred retreated in return for tribute the following year, Rollo stayed behind and was eventually bought off and sent to bother Burgundy by the Frankish king, Charles the Simple. Later, he returned to the Seine with a group of Danish followers who were called "Men of the North" or Norsemen. They invaded the area of northern France now known as Normandy.

Rather than pay Rollo to leave, as was customary, Charles the Simple realized that his armies could not effectively defend against the raids and guerrilla tactics, and decided to appease Rollo by giving him land and hereditary titles under the condition that he defend against other Vikings. Led by Rollo, the Vikings settled in Normandy after being granted the land. They subsequently established the Duchy of Normandy. The descendants who emerged from the interactions between Vikings, Franks and Gallo-Romans became known as Normans. This may explain why a noticeably higher than average rate of men living in northernwestern France today are I1.^[34]

[edit] Scandinavia

Please help improve this article or section by expanding it. Further information might be found on the talk page or at requests for expansion. (May 2008)

[edit] Haplotypes

[edit] Modal

Nordtvedt has given the following 'modal haplotypes' within the I1 haplogroup according to examples found in I1 populations.^[35] Many I1-Norse types (since the reorganization of the human Y-chromosome phylogenetic tree) have been found to be downstream of the P109 SNP, concretely defining it as a haplogroup subclade & giving further credence to Nordtvedt's method of haplotyping.^[36]

I1 Anglo-Saxon (I1-AS) Has its peak gradient in the Germanic lowland countries: north Germany, Denmark, the Netherlands, as well as the British Isles & old Norman regions of France.

I1 Norse (I1-N) Has its peak gradient in Sweden.

I1 Norse-Bothnia (I1-N-Finn) Has its peak gradient in Finland.

I1 Ultra-Norse Type 1 (I1-uN1) Has its peak gradient in Norway.

[edit] Famous

See also: Famous haplogroup members

Alexander Hamilton, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I1.^[37]

[edit] Mutations

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I1 haplogroup SNP and STR mutations.

Name: M253^[38]

Type: SNP

Source: M (Peter Underhill, Ph.D. of Stanford University)

Position: ChrY:13532101..13532101 (+ strand)

Position (base pair): 283

Total size (base pairs): 400

Length: 1

ISOGG HG: I1a

Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG

Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Name: M307^[39]

Type: SNP

Source: M (Peter Underhill, Ph.D. of Stanford University)

Position: ChrY:21160339..21160339 (+ strand)

Length: 1

ISOGG HG: I1a

Primer F: TTATTGGCATTTCAGGAAGTG

Primer R: GGGTGAGGCAGGAAAATAGC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Name: P30^[40]

Type: SNP

Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)

Position: ChrY:13006761..13006761 (+ strand)

Length: 1

ISOGG HG: I1a

Primer F: GGTGGGCTGTTTGAAAAAGA

Primer R: AGCCAAATACCAGTCGTCAC

YCC HG: I1

Nucleotide alleles change (mutation): G to A

Region: ARSDP

Name: P40^[41]

Type: SNP

Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)

Position: ChrY:12994402..12994402 (+ strand)

Length: 1

ISOGG HG: I1a

Primer F: GGAGAAAAGGTGAGAAACC

Primer R: GGACAAGGGGCAGATT

YCC HG: I1

Nucleotide alleles change (mutation): C to T

Region: ARSDP

Name: DYS455^[42]

Type: STR (repeat)

Position: ChrY:6971459..6971638 (+ strand)

Length: 180

Primer F: ATCTGAGCCGAGAGAATGATA

Primer R: GGGGTGGAAACGAGTGTT

[edit] Popular culture

Cover of the book The Tribes of Britain by David Miles, a research fellow at the Institute of Archaeology, Oxford and a fellow at Kellogg College, Oxford. He is also a former columnist for The Times.

In the book Blood of the Isles, published in North America as Saxons, Vikings & Celts: The Genetic Roots of Britain and Ireland, author Bryan Sykes gave the name of the Nordic deity Wodan to represent the clan patriarch of I1, as he did for mitochondrial haplogroups in a previous book, The Seven Daughters of Eve. Every male identified as I1 is a descendant of this man.

Another writer, Stephen Oppenheimer, discussed I1 in his book The Origins of the British. Although somewhat controversial, Oppenheimer, unlike Sykes, argued that Anglo-Saxons did not have much impact on the genetic makeup of the British Isles. Instead he theorized that the vast majority of British ancestry originated in a paleolithic Iberian people, traced to modern-day Basque populations, represented by the predominance of Haplogroup R1b in the United Kingdom today.^[43] A similar, more broad-based argument was made by Ellen Levy-Coffman in the Journal of Genetic Genealogy.^[44] The book When Scotland Was Jewish is another example. These are direct challenges to previous studies led by Luigi Luca Cavalli-Sforza, Siiri Rootsi and others.^[45] Cavalli-Sforza has studied the connections between migration patterns and blood groups. There has been some discussion of this on a mailing list at RootsWeb.^[46]

Spencer Wells gave a brief description of I1 in the book Deep Ancestry: Inside The Genographic Project.

[edit] References

[edit] See also

• Haplogroup
• Human Y-chromosome DNA haplogroups
• Haplogroup I (Y-DNA)
• Haplogroup I2 (Y-DNA)
• Norse Sagas
• Norse colonization of the Americas

[edit] Further reading

• Y-chromosome diversity in Sweden – A long-time perspective
• Y chromosome evidence for Anglo-Saxon mass migration
• A Y Chromosome Census of the British Isles
• Resolving the Placement of Haplogroup I-M223 in the YChromosome Phylogenetic Tree
• Oppenheimer, Stephen The Origins of the British: A Genetic Detective Story (Carroll & Graf, 2006) ISBN 978-0786718900
• Sykes, Bryan Saxons, Vikings, and Celts: The Genetic Roots of Britain and Ireland (W. W. Norton, 2006) ISBN 978-0393062687

[edit] External links

• I1 Project at FTDNA
• Map of I1 (Called I1a)
• Haplo-I Subclade Predictor
• Y-chromosome research by Ken Nordtvedt
• FTDNA's Y Chromosome Browser
• Review of The Tribes of Britain
• Blog on The Origins of the British
• Large Scale DNA Variation as an Aid to Reconstruction of Extended Human Pedigrees, Scandinavian and German Y haplotypes
• Discussion of Saxons, Vikings, and Celts: The Genetic Roots of Britain and Ireland
• Testing for the S-series of SNPs within I1 (Called I1a)
• Distribution of Repeat Values at Various STR Sites for Haplogroup I1 (Called I1a)
• I1 discussion forum at FTDNA (Called I1a)
• Analysis of Sykes' Data and Conclusions
• Analysis of Oppenheimer's Data and Conclusions
• I1 DYS frequencies according to Geographical Locale (Called I1a)
• Danish Demes Regional DNA Project: Y-DNA Haplogroup I1 (Called I1a)
• Dienekes Anthropology page; I1 as modal haplotype of Western Norway (Called I1a)
• Mailing List for Haplogroup I
• Haplogroup I and Its Subclades
• Northmen (Vikings) Description in The Catholic Encyclopedia
• Viking Description in the Encyclopaedia Britannica
• Why Do Europeans Have So Many Hair and Eye Colors?
• Sorenson Molecular Genealogy Foundation
• ySearch
• Ybase