Wikipedia:Articles for deletion/Log/2005 November 7

From Wikipedia, the free encyclopedia

< November 6 November 8 >

Purge server cache

Contents

[edit] November 7

The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was No Consensus (default to keep} Jtkiefer T | @ | C ----- 05:36, 13 November 2005 (UTC)


[edit] 2005 Belgian urban violence

Unencyclopedic. Wikipedia is not a daily newspaper. Karl Stas 20:46, 7 November 2005 (UTC)

  • Strong delete. Highly speculative; this article attempts to link a series of crimes to the 2005 French riots. There has been no major credible source as of yet that has described any events in Belgium as part of a connected series à la the current twelve-day riots in France. Without that, the article is, as KS notes, just a listing of some random crimes in Belgium in the last few days. Sdedeo 21:09, 7 November 2005 (UTC)
  • Strong and speedy keep this is just an attempt at censorship. freestylefrappe 22:17, 7 November 2005 (UTC)
Censorship??? Is Wikipedia to relate every fait divers in the world? Should we copy the content of our morning newspaper into Wikipedia articles? Moreover, the shooting incident in the metro is not even remotely related to the riots in France.
There have been some new copycat arsons in Brussels this evening, but as of now nothing to be compared with the wave of riots in France. Arsons, acts of vandalism, clashes between youth gangs with the police etc. happen in any major city; they may be news-worthy, but not encyclopedia-worthy. I might add that a few years ago, there have been real riots involving immigrant youths in Antwerp; similar incidents have also happened in Brussels in the past, though on a much smaller scale and less destructive than in France now. - Karl Stas 22:37, 7 November 2005 (UTC)
Your attempt at censoring the truth is blatant and the rationale is ridiculous. freestylefrappe 00:16, 8 November 2005 (UTC)
this is sarcasm, right? right? Clearly there cannot be a wikipedia article every time somebody is arrested, shot at or run over in Belgium. 130.60.142.65 11:45, 8 November 2005 (UTC)
  • Delete speculative and pointless. I've seen the Belgian riot police attending similar incidents before, this has nothing provable to do with France (and even if it did it would go in that article not as a separate one) Just zis Guy, you know? [T]/[C] :: AfD? 22:24, 7 November 2005 (UTC)
  • Delete. Speculative, OR, POV, transient (and thus unencyclopedic)...by all means, censor it right off of Wikipedia. - A Man In Black (conspire | past ops) 02:48, 8 November 2005 (UTC)
  • Speedy keep or merge It can now be clearly confirmed that the unrest has spread beyond France's borders. See, e.g., MarketWatch-- The worst civil unrest seen in France in decades entered a 12th night Monday, as riots that began outside of Paris spread to nearly 300 cities across the country and sparked similar violent outbursts in Belgium and Germany. [1] 172 | Talk 03:52, 8 November 2005 (UTC)
  • Strong keep. This and outbreaks of similar unrest across what is now being styled 'Eurabia' need to be documented. The rewriting and bowdlerism of political history to suit the narrow minded agenda of the allegedly 'politically correct' has no place in the writing of history or an encyclopedia.Sjc 04:17, 8 November 2005 (UTC)
  • keep. This is absolutely relevant to the current situation in Europe and in France. --CltFn 04:31, 8 November 2005 (UTC)
  • Keep somewhere and clean up. Whether it is kept at its current place or merged somewhere else doesn't matter to me. This is, however, valuable information, per 172. Jacqui ★ 06:41, 8 November 2005 (UTC)
  • Keep it. Clean it up, but keep it. Publications across the world are acknowledging that the violence could be spreading. Kade 06:52, 8 November 2005 (UTC)
    which is duly noted at 2005_French_riots#Possible_Spread_to_other_countries. That doesn't warrant a "Possible_Spread_of_2005_French_riots_to_other_countries article, let alone one on Belgium in particular. If we had created a new article every time the riots spread to a new town, we would have 500 independent articles now. This is ridiculous, delete as speedy. 130.60.142.65 11:47, 8 November 2005 (UTC)
  • Keep notable copycat violence. Klonimus 07:06, 8 November 2005 (UTC)
  • Comment: If this is an extension of the French problem, surely it should be covered in a single article? - Just zis Guy, you know? [T]/[C] :: AfD? 08:23, 8 November 2005 (UTC)
  • Keep If not directly associated to the civil unrest in France, it is at least a notable copycat event. -LouieS
  • delete (and recreate if it grows to notable proportions). As of now, this is covered in the article on the French riots. dab (ᛏ) 11:26, 8 November 2005 (UTC)
  • Comment all mainstream news sources have referred to the riots as either a separate incident entirely or "copycat" events. This info should not be covered in the French riots page. freestylefrappe 18:53, 8 November 2005 (UTC)
  • Delete. While the reported events are provided with proper references, each and every reference comes from the same local, non-English news web site. Moreover, the way these events are gathered into one article is deceptive and speculative, i.e. POV. There is no such thing as a "2005 Belgian urban violence" generally agreed upon in the mainstream international media. --Edcolins 21:11, 11 November 2005 (UTC)
  • Keep While the analysis is speculative, the statistics are relevant. As for those who say that the incidents in Belgium are not relevant because they are copycat events, could it not also be said that every act of vandalism and violence in France subsequent to that first incident in Clichy-sous-Bois is also a copycat event?
  • I thought that was the point? That apart form an accident of geographical boundary, they are in every sense part of the same event? - Just zis  Guy, you know? [T]/[C] (W) AfD? 20:43, 12 November 2005 (UTC)
  • Keep Keep it, but it needs to be cleaned up and updated. The table is out of date and needs to be updated. Some images or graphics showing areas affected need to be added. 202.74.219.39 20:56, 12 November 2005 (UTC)
vote disregarded by closing admin. Jtkiefer T | @ | C ----- 05:27, 13 November 2005 (UTC)
  • Keep and no merge. This would be a good sub-article to the French Riots( a very large topic) if it was rewritten in Prose, with a timeline at the bottom. Falphin 21:00, 12 November 2005 (UTC)
  • Keep - Wikipedia covers this from an encylopedic view, while Wikinews fulfils the newscasting category. -- Natalinasmpf 04:43, 13 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:52, 13 November 2005 (UTC)

[edit] 2BMates

NN website 2bmates.com. Alexa rank of 1,198,409. Google search for "link:2bmates.com" gives 33 NN hits. As per WP:WEB, Delete -- Perfecto Canada 02:17, 7 November 2005 (UTC)

  • Delete per nomination. -  Perfecto Canada 02:17, 7 November 2005 (UTC)
  • Delete wow, good nomination --anetode¹ ² ³ 02:26, 7 November 2005 (UTC)
    • Thank you. I don't know how come though. -- Perfecto Canada 17:58, 8 November 2005 (UTC)
  • Delete per nomination. *drew 02:59, 7 November 2005 (UTC)
  • Delete per nom. I would even say strong delete after seeing the nominator's striking flag. Ifnord 22:16, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by community decision. -- Psy guy (talk) 03:46, 13 November 2005 (UTC)

[edit] Alfred Fincher

This article does not contribute any new information and this person does not yet warrant a page in Wikipedia. Robby 01:34, 7 November 2005 (UTC)

  • Delete This article non-encyclopedic and may have no room to grow in the future. It is about a very minor member of the New Orleans Saints team who has contributed very little thus far (if anything). Also see: WP:NOT --Robby 01:46, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was no consensus. - Mailer Diablo 08:48, 13 November 2005 (UTC)

[edit] Aliyah Likit

Delete. This pornographic actress does not have apparent notability for inclusion in Wikipedia at this time. There is also a lack of information available from external sources, which makes an article on this person presently impossible to obtain. Joe Beaudoin Jr. Think out loud 01:36, 7 November 2005 (UTC)

  • Weak Keep filmography verified at IMDB.com --anetode¹ ² ³ 02:28, 7 November 2005 (UTC)
  • Keep and expand. Verifiable sources and 68,000 Google results from a search see [2].

Capitalistroadster 08:33, 7 November 2005 (UTC)

  • Delete, Google hits notwithstanding, she isn't overly notable in her field...--Isotope23 19:53, 7 November 2005 (UTC)
  • Comment, there are 43 pages under the subcategory "Asian Porn Stars" and 484 pages under the category "pornography related stubs" FRS 20:42, 7 November 2005 (UTC)
  • Comment And of what value will virtually all of these articles be ten years from now? Sorry, did you say "porn stars"? Make that five years from now. (Oh, and my favorite adage: "More is not always better".) Denni☯ 06:09, 8 November 2005 (UTC)
Comment It's difficult to say, but the answer isn't necessarily "none". You'll occasionally see a porn star like Traci Lords cross over into a more mainstream field. That said, we obviously shouldn't list every porn star under the rationale that they might become the next Traci Lords. I'm not voting on this one because I'm not confident in my ability to determine notability within the larger field of porn in this particular case. -Colin Kimbrell 16:30, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:14, 13 November 2005 (UTC)

[edit] Andy Boyd

Apparent vanity, please help decide.

Delete. Seems pretty clearly vanity/hoax. Many search results, but it's a common name. I don't think any of them are paticularly notable. :) Superm401 | Talk 04:44, 7 November 2005 (UTC)
  • Delete. Only the band getting some Google hits, and the assertion of its importance, keeps this from being a speedy. NatusRoma 04:49, 7 November 2005 (UTC)
  • Delete. At the same time, Another Volt should also be deleted for non-notability. Melchoir 05:31, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:19, 13 November 2005 (UTC)

[edit] Anime pack listings

Listing of quasi-legal (?) IRC trading channels... listcruft, vanity... take your pick. Doesn't seem notable for WP at any rate. W.marsh 05:29, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was No Consensus 8 delete, 5 keep/merge Jtkiefer T | @ | C ----- 05:41, 13 November 2005 (UTC)


[edit] Apartheid outside South Africa

This article is a biased joke, attempting poor comparisons with apartheid in South Africa. It's only references are simply 'opinion' from radio and the media in general. What it mostly describes is Racial segregation (and attempts to characterise any instance of that, or any instance hinting of it - as apartheid), which is already covered in that article. Other articles already accurately (and without the bias) deal with what is in this one. Cheers, - >>michaelg | talk 05:41, 7 November 2005 (UTC)

  • Delete - Agree. --Hottentot
  • Delete - Personal essay. SlimVirgin (talk) 06:48, 7 November 2005 (UTC)
  • Delete - I'm sorry to suggest deletion for an article that so many people have worked on, but that "arguments are sometimes made" doesn't make something worthy of an encyclopedia entry. --William Pietri 07:26, 7 November 2005 (UTC)
    • Merge. For any section that has multiple sources, merge to that section's base article. E.g, move references about Israeli "apartheid" to article on Israeli-Palestinian conflict. --William Pietri 21:19, 8 November 2005 (UTC)
Or to racial segregation Unbehagen 12:41, 9 November 2005 (UTC)
  • Delete Apartheid was a South African system, and only a South African system. CalJW 13:56, 7 November 2005 (UTC)
  • Delete - although some people do use apartheid as a synonym of any kind of segregation, racial included, it is not accurate - Skysmith 15:06, 7 November 2005 (UTC)
  • The Apartheid is the former system of segregation in South Africa. However, the international law defines a crime against humanity of apartheid; basically, as any crime against humanity - such as murder, torture, or persecution - committed in the context of a regime of racial oppression. (See, for example, the elements of crimes at the web site of the International Criminal Court.) The allegiations against other countries may well be worth a mention; in the main apartheid article if not in a separate one. The current article is too biased, so my vote is cleanup, and then either keep or merge. - Mike Rosoft 22:32, 7 November 2005 (UTC)
  • Delete as per nomination. Jayjg (talk) 22:46, 7 November 2005 (UTC)
  • Delete inclusion is arbitrary and not defined, duplicate with racial segregation JFW | T@lk 01:30, 8 November 2005 (UTC)
  • Keep or merge with apartheid, then clean up. (I'd prefer a merge to a keep.) I'm surprised at the nom that "It's [sic] only references are simply 'opinion' from radio and the media in general." This article is more sourced than half of the others I have seen on Wikipedia today! If a large group of media outlets keep making the same point, whether or not one agrees with it, that's noteworthy, IMO. Jacqui ★ 06:18, 8 November 2005 (UTC)
    • Is that really sufficient to have an encyclopedia entry about it? Many more media commentators have questioned the intelligence of George Bush or the honesty of John Kerry, but I'd have an issue with an article about either of those based only on the fact that people in the media have said it. If this material is worth keeping (which I'm not yet seeing), I'd rather see it in articles about the things people are comparing Apartheid to. I.e., Israel, Saudia Arabia, Spain, Jim Crow laws. --William Pietri 06:54, 8 November 2005 (UTC)
      • The George W. Bush and John Kerry articles should have information on the fact that media outlets keep asking certain questions about them, yes. Just like an article about apartheid should have information about how the word/concept is currently being used by the media. I am interested in keeping the information no matter what, but I think it's true that the information would fit better into apartheid for the valid reason you list. Jacqui ★ 20:40, 8 November 2005 (UTC)
        • Good point. I'm changing to merge as well. Hooray for consensus! --William Pietri 21:19, 8 November 2005 (UTC)
  • Delete for reasons stated by michaelg, in particular the fact that the material is dealt with elsewhere. It strikes me as ironic that Jim Crow is discussed as a form of apartheid, when Jim Crow pre-dated apartheid by many years. Perhaps the main article on apartheid should be re-titled "Jim Crow outside the United States." (I jest. But the point is, Jim Crow was bad enough, and its own article describes it as being bad enough, without adding the irrelevant fact that it is sort of like some other phenomenon on another continent that was just starting as Jim Crow, thankfully, was nearing its end.) 6SJ7 21:59, 8 November 2005 (UTC)
  • Merge But what's the betting that at least one country gets "lost" en route. Unbehagen 12:41, 9 November 2005 (UTC)
  • Clean Up - I disagree with Michael. Deletion request comes from a claim that the article is "liberal-slant"- pov, irrelevant to whether the article has merit. The article has substantiation in facts, outside of radio and media.
    • Merge After reconsidering, I understand Michael's logic. I think the sections of the article are best sent to articles that more clearly explain the issues they raise.Varun Vuppala
  • Keep and expand - Well sourced and refrenced and encyclopeadic, no valid NPOV reason to delete.--Irishpunktom\talk 11:03, 12 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by unambiguous and unanimous community decision. -- Psy guy (talk) 03:47, 13 November 2005 (UTC)

[edit] Aper

Seemingly NN band, no assertion of notability or any WP:MUSIC criterion. No allmusic entry. Difficult to Google due to indistinct name. Band formed in 2003, according to the one-sentence article. —Wahoofive (talk) 06:52, 7 November 2005 (UTC)

Delete Per nom KnowledgeOfSelf | talk. 07:04, 7 November 2005 (UTC)

  • Delete per nom. - Dalbury (talk) 00:25, 8 November 2005 (UTC)
  • Delete per nom. *drew 01:00, 8 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by unambiguous and unanimous community decision. -- Psy guy (talk) 03:48, 13 November 2005 (UTC)

[edit] Asima

Self-promotion of non-notable band. Thue | talk 21:04, 7 November 2005 (UTC)

  • Delete as per nom. PJM 21:24, 7 November 2005 (UTC)
  • Delete NN band vanity, and incoherent at that - what festival? Never mind. It's probably the Festival of Never-To-Be Notable Bands Trying To Get On Wikipedia. - Just zis Guy, you know? [T]/[C] :: AfD? 22:11, 7 November 2005 (UTC)
  • Delete Tintin 00:39, 8 November 2005 (UTC)
  • Delete NN --Rogerd 03:26, 10 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:59, 13 November 2005 (UTC)

[edit] AUMC Youth Choir

Doesn't really assert anything that I see as being notable about the group. Would fail WP:Music if looked at that way. Delete. W.marsh 02:35, 7 November 2005 (UTC)

  • They certainly fail the Google Test given that a Google search gets 0 results see [3]. A search for the full name received one Google hit at the Church page see [4]. They fail both WP:NMG and arguably WP:V. Delete.Capitalistroadster 02:55, 7 November 2005 (UTC)
  • Delete as vanity and non-notable. Deltabeignet 03:11, 7 November 2005 (UTC)
  • Delete. Vanity. Advertisement. Non-notable. --Robby 19:01, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by community decision. -- Psy guy (talk) 03:50, 13 November 2005 (UTC)

[edit] Badboy

Nonnotable performer, vanity article, see also The Badboy, Karaoke Badboy, Delete Dvyost 07:36, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by unambiguous and unanimous community decision. -- Psy guy (talk) 03:52, 13 November 2005 (UTC)

[edit] Basecolorpalette

This is too trivial for an entry in an encyclopedia. Thue | talk 21:02, 7 November 2005 (UTC)

  • Delete, orphan substub, almost A1 speedy. Can always be recreated if someone feels they can write an actual article about it. —Ilmari Karonen (talk) 21:28, 7 November 2005 (UTC)
  • Delete per above. An encyclopaedic entry on base colour palettes would not have this title anyway, and this is not a computer manual. Just zis Guy, you know? [T]/[C] :: AfD? 22:13, 7 November 2005 (UTC)
  • Delete UE --Rogerd 03:24, 10 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was dealt with by copyvio. - Mailer Diablo 08:47, 13 November 2005 (UTC)

[edit] Bauçà i Rosselló, Miquel

POV ("a first book that dazzled the critics"); nn? Delete if nn, or cleanup if verified. NSLE (讨论) \<extra> 09:59, 7 November 2005 (UTC)

  • Copyvio (mostly) from [5]. So delete, as we do all such infringing articles. — Haeleth Talk 23:19, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by unambiguous and unanimous community decision. -- Psy guy (talk) 03:54, 13 November 2005 (UTC)

[edit] Benjamin Golding

I can't find anything on this "author". Without verifiable references, we should Delete. A D Monroe III 19:02, 7 November 2005 (UTC)

Additional info: according to this entry in 1988, Ben is 17 years old. --A D Monroe III 19:50, 7 November 2005 (UTC)
  • Delete as vanity (and delete his link at 1988 too if this AFD is sustained). Eddie.willers 20:29, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:36, 10 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was keep. Kirill Lokshin 01:08, 13 November 2005 (UTC)

[edit] Big chocolate

Original research/neologism. ERcheck 03:31, 7 November 2005 (UTC)

  • Delete per nomination. ERcheck 03:31, 7 November 2005 (UTC)

*Delete I don't doubt that Big Chocolate does exist, but their influence is negligible, certainly low enough below the bar for notability on Wikipedia. -Greg Asche (talk) 04:11, 7 November 2005 (UTC)

  • Delete, per GregAsche and nominator. Superm401 | Talk 04:20, 7 November 2005 (UTC)
  • Delete - funny, but not notable. BD2412 T 05:04, 7 November 2005 (UTC)
    • Vote changed to keep, per Uncle G's scrupulous documentation. BD2412 T 15:19, 7 November 2005 (UTC)
  • Research reveals that this isn't original research, and that it is fairly widely held view that there is a group of multinational chocolate companies known as "Big Chocolate". Although there is some overlap between this and ground that we already cover in chocolate and slavery, there is also ground here that is not covered in that latter article. Keep. Uncle G 14:22, 7 November 2005 (UTC)
Keep article. Additionally, I will annouce here that I am suggesting a merge of chocolate and slavery into this article. Jacqui ★ 06:10, 8 November 2005 (UTC)
  • Keep as per Uncle G. Influential in chocolate-growing regions and apparently in EU trade politics. FreplySpang (talk) 14:37, 7 November 2005 (UTC)
  • Keep. A well-documented article. -Willmcw 20:46, 7 November 2005 (UTC)
  • Keep per User:Uncle G. - Dalbury (talk) 00:08, 8 November 2005 (UTC)
  • keep please because of what uncle g said Yuckfoo 01:22, 8 November 2005 (UTC)
  • keep the article: part of current affairs and widely published about in the media and do not merge with chocolate and slavery: that article deals with a entirely different issue. V8rik 15:36, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:51, 13 November 2005 (UTC)

[edit] Bigelow Grille

Appears to be a NN restaurant, a quick google search gets a few hits, but mostly cut and past text from the hotel's website, phrased more as an amenity to the hotel. Fallsend 20:43, 7 November 2005 (UTC)

  • Delete Per Nomination. Fallsend 20:43, 7 November 2005 (UTC)
  • Delete nn restaurant. Unless they want to fly me over there first class and let me sample their notable cooking, in which case I'm sure I'd change my vote. Maybe. Just zis Guy, you know? [T]/[C] :: AfD? 22:25, 7 November 2005 (UTC)
  • Delete advert --Rogerd 03:22, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:52, 13 November 2005 (UTC)

[edit] Bio Ninja Circus

(AFD includes Bio Ninja Circus, Nostalgebra and The McGuyvers of Common Sound.) Appears to be standard band vanity, complete with coverage of the kayfabe rather than the actual facts ("featuring five year old material which they wrote 20 years from now" and the like.) No sign of meeting WP:MUSIC guidelines. -- Antaeus Feldspar 21:28, 7 November 2005 (UTC)

  • Delete per own nom. -- Antaeus Feldspar 21:28, 7 November 2005 (UTC)
  • Delete per nom, and per the article itself, which is practically begging to be speedied as nonsense. - Just zis Guy, you know? [T]/[C] :: AfD? 22:22, 7 November 2005 (UTC)
  • Delete per nom - and indeed per the article itself, which is practically begging to be speedied as nonsense. Just zis Guy, you know? [T]/[C] :: AfD? 22:22, 7 November 2005 (UTC)
  • Delete vanity --Rogerd 03:10, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete by community decision. -- Psy guy (talk) 03:56, 13 November 2005 (UTC)

[edit] Black Order

Strong evidence of being a vanity page (info about a local band that has yet to even release a demo contributed by a single unregistered author) and the information provided is not significant enough to be included in any encyclopedia. - DNewhall 5:12 Nov. 7, 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy delete. - Haukur Þorgeirsson 15:49, 12 November 2005 (UTC)

[edit] Black owned

Speedy delete. Nonsense... and that's putting it nicely. Edwardian 07:45, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy delete (A2). Physchim62 (talk) 13:07, 13 November 2005 (UTC)

[edit] Blackberry mush

Has been transwikied, no encyclopaedic value. Ingoolemo talk 08:07, 7 November 2005 (UTC)

  • Currently no info on cultural significance (if any). Delete because wikipedia is not a recipebook. Jacqui ★ 06:28, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy deleted as link spam at the same time it was being introduced on AfD

[edit] BNet.co.nr

Advertising a non-notable website ➨ ❝REDVERS❞ 22:42, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete Jtkiefer T | @ | C ----- 05:44, 13 November 2005 (UTC)


[edit] Boyoh

Delete A made up language spoken by three people isn't quite wikipedia material. Krzypntbllr 23:22, 6 November 2005 (UTC)

  • Delete, vanity. User:Zoe|(talk) 23:31, 6 November 2005 (UTC)
  • Delete per Zoe, and also extremely non-notable. Paolo Liberatore (Talk) 18:15, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedy deleted. (07:30, 11 November 2005 R. fiend deleted "Breakfastbunch") - Mailer Diablo 08:51, 13 November 2005 (UTC)

[edit] Breakfastbunch

non-notable website. Thue | talk 20:52, 7 November 2005 (UTC)

  • Delete oh how hilarious they are! To an audience of each other, anyway. Non-notable and never will be. Just zis Guy, you know? [T]/[C] :: AfD? 22:28, 7 November 2005 (UTC)
  • Delete NN --Rogerd 03:22, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. — JIP | Talk 09:27, 13 November 2005 (UTC)

[edit] Brendon Martinez

No Vote I tried looking up a number of strings and found it to be non-verifiable on Google and also on sensis.com.au. I also looked up http://www.imdb.com/title/tt0464866/fullcredits (Ikaw Ang Lahat Sa Akin on IMDb) and found no mention of him. However, I have found some hits with the thread Brandon Martinez Kanta na Pag-Ibig on Google (as the page might be a typo), but all the writing with this in appears to be in Tagalog/Filipino, which I cannot read. I thought that this might be the reason why the db-bio I put on the page originally disappeared, but since that was removed by the article creator, I am starting to think that the article might be nothing more than vanity and male cow faeces. My main doubt as to whether or not the page has grounds for deletion is the Tagalog/Filipino I found, hence my listing here with no vote rather than re-db'ing it. Sorry if I'm cluttering up AfD with this. -LichYoshi 11:42, 7 November 2005 (UTC)

  • Speedy delete If we can't prove the notability despite trying and the author removes the db-bio without giving a clue why the person is notable, then it remains db-bio-able. ➨ ❝REDVERS❞ 20:21, 7 November 2005 (UTC)
    • The db-bio criterion requires that the article not even claim notability in a plausible way. This article claims the guy is famous as an actor, so it's not a speedy. Non-verifiability is not a speedy criterion: one of the reasons why the AfD process takes so long is that you have to give people time to look for verification. — Haeleth Talk
  • Delete (but not speedily) as non-verifiable, unless someone steps in with a reference. — Haeleth Talk 23:25, 7 November 2005 (UTC)
  • Keep Poor ability to search a topic does not make it less than notable. Certainly proof would do it justice, but seeing as the actor is from a foreign country and IMDB as well as Google have not the database extensive enough to search every subject, I believe this article provides information on a topic that is not found in those places thus making it quite valuable to Wikipedia Big Booger 15:12, 8 November 2005 (UTC)]
    • However, poor ability to search a topic does make it non-verifiable, and it is a fundamental policy that we only include information we are able to verify. Proof would not merely "do it justice": proof is an absolutely basic requirement, without which the article is not appropriate for inclusion on Wikipedia. — Haeleth Talk 16:56, 8 November 2005 (UTC)
    • What you suggest would be construed as Original research. -LichYoshi 14:50, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Merge to Imperial Way Faction. Physchim62 (talk) 13:21, 13 November 2005 (UTC)

[edit] British diplomatic movement also political struggle between Toho Kai and Kodoha groups in 1942

  • Delete. Merged with Imperial Way Faction under Political Development. - splot 15:12, 6 November 2005 (UTC)
  • At this point, RHaworth closed this afd and tagged the article as a speedy, saying "{{vt}} delete for reason given below. (This AfD was never linked into an AfD log file.) -- RHaworth 11:57, 7 November 2005 (UTC)". —Cryptic (talk) 12:11, 7 November 2005 (UTC)
  • Redirect (or archive in the talk namespace). Deletion is not the last step of an article merger; the history must be preserved for GFDL compliance. And it's certainly not a speedy, in any case. —Cryptic (talk) 12:11, 7 November 2005 (UTC)

Comment: article has been archived at Talk:Imperial Way Faction/Merge archive. Physchim62 (talk) 13:21, 13 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:49, 13 November 2005 (UTC)

[edit] Bruce (family)

Ha ha. Someone has way too much time on their hands. Actually good material, but perhaps rather more suited to a satirical website than an encyclopaedia. Mais oui! 16:36, 7 November 2005 (UTC)

  • Delete, nonsense.--Isotope23 16:50, 7 November 2005 (UTC)
  • Delete nonsense. Obviously they read Private Eye... Possible BJAODN? - Just zis Guy, you know? [T]/[C] :: AfD? 17:12, 7 November 2005 (UTC)
  • Delete, ridiculous. No BJAODN, it just encourages them. --Angr/tɔk tə mi 17:20, 7 November 2005 (UTC)
  • Delete per nom. PJM 17:30, 7 November 2005 (UTC)
  • Delete per Angr; not good enough for BJAODN. Paolo Liberatore (Talk) 17:38, 7 November 2005 (UTC)
  • Can we Speedy delete this?--Mais oui! 18:31, 7 November 2005 (UTC)
  • Delete per above. *drew 01:09, 8 November 2005 (UTC)
  • Um, redirect to Robert I of Scotland, maybe? BD2412 T 03:45, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:44, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Merge/Redirect Jtkiefer T | @ | C ----- 05:49, 13 November 2005 (UTC)


[edit] Burnt Bridge, Victoria

  • Burnt Bridge is not an actual suburb
  • ... or so says User: Fleer. My atlas disagrees, pointing to Burnt Bridge (or Burnt-Bridge) being part of the larger suburb of Croydon, Victoria. The presence of 62,000 google hits for "Burnt Bridge"+Melbourne seems to support that. Keep, and fix up if necessary. Grutness...wha? 03:36, 7 November 2005 (UTC)
  • Comment. It isn't a suburb so our article is wrong.Melways Melbourne Street Directory doesn't have a listing for a suburb or locality. Geoscience Australia, say that there is an actual place called Burnt Bridge, Victoria. However, I was interested to see Grutness's reference. However, it is a road or trail in Victoria see [6]. A Google search for Victoria, "Burnt Bridge" - Vancouver (to exclude a place on the island of Victoria off Vancouver) gets 32,900 hits with indications that it is a popular area with mountain bikers see [7]. After all that, I would vote for a Merge with Croydon, Victoria which could do with some expansion. I reserve my position on the Gippsland trail.Capitalistroadster 03:57, 7 November 2005 (UTC)
  • Note: This debate has been included in the list of Australia-related deletions. . I will also see if I can put something about this vote on the Australian Wikipedians page and Wikiproject Melbourne. Capitalistroadster 04:05, 7 November 2005 (UTC)
  • Keep but redirect and merge into Croydon, Victoria. It is a small shopping village within the suburb of Croydon, but not a suburb unto itself. From the Croydon Conservation Society website [8]: "Maroondah is an amalgamation of a wide variety of areas from the business- city type precinct, Ringwood, to a country town hub, Croydon. It also includes Heathmont, Burnt Bridge, McAdam Square, and a variety of smaller business areas". --Cnwb 04:48, 7 November 2005 (UTC)
Further to this, the excellent Australian Places Gazetteer website, run by Monash University, states [9]: "Early settlement points in Ringwood East were the Burnt Bridge Hotel on the Maroondah Highway in the 1860s...". this indicates to me that the location was a pre-Ringwood settlement, complete with hotel (although in those days, anywhere with a population of at least 2 would have a hotel). -- Cnwb 05:02, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:46, 13 November 2005 (UTC)

[edit] Buying land

WP is not a "How to..." Bookandcoffee 04:03, 7 November 2005 (UTC)

  • Delete as noted. --Bookandcoffee 04:03, 7 November 2005 (UTC)
  • Delete may be vanity/advert (see links at bottom), definently a how-to and I don't see how this could be made encyclopedic. --W.marsh 05:08, 7 November 2005 (UTC)
  • Speedy delete A not too subtle ad. Marcus22 10:47, 7 November 2005 (UTC)
  • No vote, but if deleted, maybe redirect to conveyancing, since someone unfamiliar with the technical term might search on "buying land". AndyJones 18:00, 7 November 2005 (UTC)
  • Delete and Redirect per AndyJones. (I've never heard the term "conveyancing", and I'm sort of trying to buy land.) Bikeable 22:45, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:10, 13 November 2005 (UTC)

[edit] Carlo Terracciano

Unsourced and no claim of notability made for the person in my opinion. I submitted this for speedy delete but it was rejected for some unexplained reason, so I'll submit it here instead. Caerwine 04:02, 7 November 2005 (UTC)

The admin who removed the speedy tag did provide some justification ("seems notable enough"). One doesn't necessarily agree with that, of course. — Haeleth Talk
  • Delete nn bio. No claims are made that this individual meets the WP:BIO criterion of being more notable than the average college professor. No publications cited. I see just 782 hits for the name on Google, which wouldn't be very impressive even if we assume they're all about the same person, and there's no article on him on the Italian Wikipedia. — Haeleth Talk 18:52, 7 November 2005 (UTC)
  • Delete No evidence his work was ever published in or translated into English. The same anon IP address first inserted, then removed, this: "He is the author of several books and was the chief-editor of the magazine Eurasia: Rivista di studi Geopolitici." FRS 01:23, 8 November 2005 (UTC)
    • "No evidence his work was ever published in or translated into English" - I don't see how that would be a relevant deletion criterion. u p p l a n d 07:22, 8 November 2005 (UTC)
  • Well, this is the English language WP, after all. The only Google hits I saw for him were in Italian. If he's never written in English, or been mentioned in an English language article, it's hard to understand why a user of THIS encyclopedia would ever have an interest in himFRS 14:20, 8 November 2005 (UTC)
  • Comment: some of the Italian-language Google hits seem quite substantial. He appears to have been a fascist theoretician of some kind, and possibly notable within contemporary Italian fascism (which is not insignificant). To be keepable, the article needs somebody to improve it who knows Italian and the relevant political and cultural context. I'm abstaining for now. u p p l a n d 07:22, 8 November 2005 (UTC)
  • It's improved enough now for me to change from Delete to Weak Delete, but it'll need more to cause me to think it's an article that should be kept. Caerwine 18:43, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. - Mailer Diablo 08:51, 13 November 2005 (UTC)

[edit] Case Study KSS: Acid Rain

Appears to be original research ➨ ❝REDVERS❞ 14:05, 7 November 2005 (UTC)

  • Delete; per nom -James Howard (talk/web) 14:35, 7 November 2005 (UTC)
  • Delete per nom. Should remember to vote myself! ➨ ❝REDVERS❞ 14:54, 7 November 2005 (UTC)
    • You probably shouldn't, actually. You've made your arguments in the nomination, so what good does it do? fuddlemark (fuddle me!) 15:30, 7 November 2005 (UTC)
      • The instructions advise you to do so, of course... but I think you're right and won't in future. This must be my subconsious reason for forgetting! :) ➨ ❝REDVERS❞ 16:55, 7 November 2005 (UTC)
        • Comment there are at least two reasons for voting, even if one is the nominator; first, one may nominate and still remain neutral (this is for example if you are not sure and nominated the article to collect other opinions); this really happens sometimes; I think there are at least one or two such cases in the votes for today; the second reason is that it facilitates the task of the closing administrator in counting the votes. Paolo Liberatore (Talk) 00:01, 9 November 2005 (UTC)
          • It's the nominator's job to get the ball rolling on the argument for deletion. I don't see that it matters whether a nomination gets counted as a vote. If you're right about the article, and you do your job well, you'll have all the influence you need just from persuading others to vote. fuddlemark (fuddle me!) 02:44, 9 November 2005 (UTC)
        • Comment I am not saying that one must necessarily vote. The instructions for AfD say that you can cast the first vote, not that you have to. Your reasoning for not voting are also reasonable. Paolo Liberatore (Talk) 11:55, 9 November 2005 (UTC)
  • Delete, original research. Looks like someone publishing their lecture notes. fuddlemark (fuddle me!) 15:30, 7 November 2005 (UTC)
  • Delete as original research. Paolo Liberatore (Talk) 17:55, 7 November 2005 (UTC)
  • Delete per nom. - Just zis Guy, you know? [T]/[C] :: AfD? 18:19, 7 November 2005 (UTC)
    • my take is this page is probably in progress... give it some time to be furnish. The content is relevant and fine... just needed an editorial touch... KEEP IT.--Maybelline Tan 03:29, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 13:23, 13 November 2005 (UTC)

[edit] Charmed Forever Forums

TV show is notable. Role-playing forums based on TV show are not.

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:22, 7 November 2005 (UTC)
  • 49 members? If WP:WEB was official this would fail by a light year. Good show, but delete the forums. Saberwyn 06:54, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was to Delete the article. =Nichalp «Talk»= 07:40, 13 November 2005 (UTC)

[edit] Cholayil

Doesn't seem notable, more like an advertisement or brochure. Fallsend 09:45, 7 November 2005 (UTC)

  • Delete per nomination (NN Company). - Fallsend 09:45, 7 November 2005 (UTC)
  • Comment I haven't decided what to vote for. One of their products - this soap - is popular. They claim at their site that they make Cuticura Talcum Powder [10]. AFAIK, Cuticura is an American or European product, but if it can be ascertained that this company atleast makes the Indian version, I would be tempted to vote to keep the article (with a major cleanup/rewrite). Tintin 00:38, 8 November 2005 (UTC)
  • Delete. NN advertising. Cuticura is definetly notable but was manufactured by UK based Keyline, and was acquired very recently by Godrej. I think, this company may manufacture cuticura in the same way a pepsi bottler produces pepsi. See [11].

--Pamri • Talk • Reply 14:49, 8 November 2005 (UTC)

  • Delete as per Pamri. Tintin 16:56, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. -- ( drini's vandalproof page ☎ ) 07:09, 14 November 2005 (UTC)

[edit] Chud (disambiguation)

Nothing links here, no need for this disambiguation. Doesn't fit any speedy criterion, and it's not just a redirect, so here it is. brenneman(t)(c) 10:14, 7 November 2005 (UTC)

  • Delete If it serves no purpose, I think it can be speedied. Be bold! Dottore So 12:04, 7 November 2005 (UTC)
  • Delete. 'Nothing links here' isn't a reason to delete a disambiguation page - nothing should link to disambiguation pages except the back links however this page should still be deleted because it links to 2 pages, one of which has been deleted (chud = homeless people) and the other of which is spelled differently.Filceolaire 13:31, 7 November 2005 (UTC)
  • Comment no opinon on deletion, but I've never heard Chud refer to homless people... and the link to the most common usage isn't even explained... Man I loved that movie.--Isotope23 17:10, 7 November 2005 (UTC)
  • Keep (see below); webster online says that the word exists, but is not in the free version [12]; can anyone verify this one? my paper dictionary has no entry for chud (yes, I checked a paper dictionary, believe it or not); urbandictionary has more than one entry on that, none indicating homeless people [13]. Anyway, there are two pages in wikipedia that one wants to disambiguate (chud and chudes), and disambiguation pages exist for that. I have changed the page to reflect the actual content of the links. Paolo Liberatore (Talk) 18:33, 7 November 2005 (UTC)
    • Comment in that case this is a dicdef though... not exactly a strong case to keep the wikipedia article...--Isotope23 21:14, 7 November 2005 (UTC)
      • Comment to clarify. Currently, the disambiguation page is about chud, which redirects to C.H.U.D., the movie and chudes, the people. If this looks reasonable, the disambiguation page should be kept even wihout the dictdef chud=homeless. Paolo Liberatore (Talk) 21:32, 7 November 2005 (UTC)
        • Comment, sorry... misunderstood your original post. Thanks for the clarification.--Isotope23 03:46, 8 November 2005 (UTC)
  • What happened. A tangental AfD made me think of this film. I typed in the actual title C.H.U.D and ended up on Chud, with the note "Redirected from CHUD" and the "Other uses - Chud" tag. The first line of Chud said it was another name for homeless people, and it was never mentioned again in the article. Once that was removed as unsourced, it was a movie under the wrong title, simple. Once that was fixed (moved content back to C.H.U.D., tidied layout, fixed redirect, etc) the disambiguation made no sense to me. These things do not have the same name, no possibility for confusion exists, unless there is a reasonable possibility that people will type "Chud" when looking for Chudes? - brenneman(t)(c) 23:09, 7 November 2005 (UTC)
    • Comment; I had never heard of the Chudes before and had never saw the movie. My point is that the article about chudes calls the single person of the group a chud. That one searches chud while looking for the people therefore seems to me a quite likely possibility. It is not even completely clear to me why chud should redirect to C.H.U.D. and not to chudes, given that chud is the correct spelling for a single person of the chudes and the wrong spelling for the acronym of the movie.
In passing, I am not criticizing the nomination -- the original disambiguation page was a reasonable candidate for AfD given that it contained only a real link and a dictdef. I think that the best possible configuration is that: 1. chud is removed; and 2. chud (disambiguation) is moved to chud. Or, if you prefer, the content of chud (disambiguation) is moved to chud (deleting the redirect directive) and the former is removed. This second solution has the advantage that the page to remove is already here on AfD. Paolo Liberatore (Talk) 00:12, 8 November 2005 (UTC)
Even better: Normal form for (non-mythical) people appears to be singular: Inuit, Aborigine. Thus move Chudes to Chud put {{other uses}} at the top of it and C.H.U.D., leave CHUD pointing as it is now, and still delete this disambig.
brenneman(t)(c) 04:04, 8 November 2005 (UTC)
  • Comment very good idea. I agree. Paolo Liberatore (Talk) 12:02, 8 November 2005 (UTC)
  • Comment I have requested moving chudes to chud, which is voted in Talk:Chudes. Paolo Liberatore (Talk) 17:08, 11 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. - Mailer Diablo 08:53, 13 November 2005 (UTC)

[edit] Chud.com

Not notable website. Delete abakharev 06:20, 7 November 2005 (UTC)

  • Keep and Cleanup. Actually, it's a pretty notable movie website. Not in league with AICN or E! Online, but still notable. -- Grev -- Talk 06:30, 7 November 2005 (UTC)
  • Delete. With an Alexa rank of 16,620 it doesn't meet Wikipedia:Websites. If there's some reason Chud.com is notable, the article gives no hint. Nominator may also wish to consider nominating Nick_Nunziata, the presumed vanity page created in the same editing pass. --William Pietri 08:00, 7 November 2005 (UTC)
    • Proposed guideline, WP:WEB is. However, as an active contributor to it, I'd like to suggest everyone truck over there and do what's required to make it actual. - brenneman(t)(c) 09:45, 7 November 2005 (UTC)
  • Delete as not notable. Nothing on Google news, no indication of notability at Google groups either, and finally what links here isn't too impressive. Always open to some demonstration of said notability, e.g. some mention in major media. - brenneman(t)(c) 09:45, 7 November 2005 (UTC)
  • Delete per above. Dottore So 11:58, 7 November 2005 (UTC)
  • Delete per nom... they should be smacked for appropriating the acronym of the Cannabalistic Humanoid Underground Dwellers.--Isotope23 17:12, 7 November 2005 (UTC)
  • Delete; non notable. Search for the number of links to chud.com not on chud.com themselves gives 178 hits. Paolo Liberatore (Talk) 19:08, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:41, 13 November 2005 (UTC)

[edit] Chupacabra (band)

Band substub, fails WP:MUSIC. Despite claims in the article, the band appears to have split in 2001. [14] —Ilmari Karonen (talk) 21:02, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was NO CONSENSUS. — JIP | Talk 09:29, 13 November 2005 (UTC)

[edit] Corn soup

Already transwiki-ed, no reasonable potential for encyclopedic expansion. brenneman(t)(c) 01:01, 7 November 2005 (UTC)

  • Delete. Do we really need to go through this technicality, or can we speedy this as A5 now? -R. fiend 05:35, 7 November 2005 (UTC)
    • Meh. It's not a particularly good article, but at least it's no longer a recipe (which really is all it was at nomination). Keep, there's more said about it than I thought there would be, though it still isn't all that much beyond "it's a soup made of corn." -R. fiend 06:47, 11 November 2005 (UTC)
  • Speedy. Definitely A5. Ingoolemo talk 07:58, 7 November 2005 (UTC)
  • Speedy as identical copy of material on another MediaWiki project. Wikipedia is NOT a cookbook. - Mgm|(talk) 08:23, 7 November 2005 (UTC)
  • (Speedy) Delete as above. NSLE (讨论) \<extra> 08:32, 7 November 2005 (UTC)
  • Keep and improve. It's ridiculous if the WP doesn't have an article on such a simple topic. Deryck C. 09:37, 7 November 2005 (UTC)
  • Comment Unless there is another deletion debate that I don't know about, this isn't an A5 candidate. That's for when the outcome of a debate is to tranwiki, this appears to have happened in the opposite order. Just to be pedantic, sorry. - brenneman(t)(c) 09:53, 7 November 2005 (UTC)
    • That's not being pedantic at all, for any admin to speedy this would be grossly overlooking the rules. A5 states, "# Any article that has been discussed at Articles for Deletion (or Miscellany for deletion), where the outcome was to transwiki, and where the transwikification has been properly performed and the author information recorded". So, if consensus here becomes transwiki then we can speedy this article.
  • Speedy Per nom. --Robby 15:46, 7 November 2005 (UTC)
  • Keep, more common in the Western world than things like dahl... and, it can stay a stub for now (the recipe stuff should be removed). gren グレン 17:53, 7 November 2005 (UTC)
  • Delete. This is not a recipe book. Take out the recipe and you have: corn soup is soup made of corn. Who'd have guessed? And at that it would be a dicdef. Unless there is special social or cultural significance to this, which would be encyclopaedic, I don't see how it has a place here. - Just zis Guy, you know? [T]/[C] :: AfD? 18:57, 7 November 2005 (UTC)
    • Read my reply below, there is room for expansion. Falphin 02:54, 8 November 2005 (UTC)
  • Delete. I don't see any potential for expansion either. PJM 19:09, 7 November 2005 (UTC)
  • Keep, popular food for Native Americans of the Seneca nation. Kappa 00:44, 8 November 2005 (UTC)
  • Strong Keep whats this craziness? We have articles on all kinds of food and the article isn't a recipe. Why not vfd cherry coke? And it does have a chance of expansion(local varieties, variations, etc). Falphin 02:53, 8 November 2005 (UTC)
    • To go along with this line of questioning, I thought of the article on Shirley Temple cocktail when reading this debate. The article up for deletion has far more information on significance. The Shirley Temple gets by on noting that it was named after a child actress. Jacqui ★ 05:59, 8 November 2005 (UTC)
      • Agreed, other foods of similar importance have articles so I don't see why this one shouldn't. Take Pecan pie for example.(Survived a VFD). Falphin 22:17, 8 November 2005 (UTC)
  • Keep, but remove recipe. The current precendent is to keep articles about food if they have encyclopedic content, such as that on cultural significance, which this one does. However, it is correct that wikipedia is not a recipe book. Jacqui ★ 05:57, 8 November 2005 (UTC)
  • Keep, but remove recipe. — Instantnood 09:02, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was no consensus, (17 merge, 13 keep, 9 delete), see Wikipedia:Articles for deletion/Cricket matches articles for details. - Mailer Diablo 09:52, 14 November 2005 (UTC)

[edit] Cricket matches articles (508 nominated articles total)

The contents of this page is too long to be listed on Articles for deletion. Please see: Wikipedia:Articles for deletion/Cricket matches articles. It should be noted that the list is still being compiled. --AllyUnion (talk) 12:15, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy delete. Joke article. Though the claim best goalie on this planet clearly means that A7 does not apply :). Thue | talk 21:09, 7 November 2005 (UTC)

[edit] Daniel Dahm

apparent vanity related to vandalism at Mighty Ducks of Anaheim ccwaters 14:46, 7 November 2005 (UTC)

  • Delete per nom, and seems to meet speedy G1, A1 and A7 as well. Just zis Guy, you know? [T]/[C] :: AfD? 17:49, 7 November 2005 (UTC)
  • Speedy delete. Searching "Daniel Dahm" and "goalie" yields no Google results, so vanity. BrianSmithson 18:24, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.


The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was del. mikka (t) 19:30, 12 November 2005 (UTC)

[edit] Dechronification

  • del nonnotable magic bullet against aging. Only 42 unique google hits, most of them being copies of 2-3 texts. mikka (t) 19:26, 7 November 2005 (UTC)
  • Delete this is pure sci-fi Just zis Guy, you know? [T]/[C] :: AfD? 22:26, 7 November 2005 (UTC)
  • Delete any notable text on the concept should move to the article about the guy. SchmuckyTheCat 00:44, 8 November 2005 (UTC)
  • Delete junk --Rogerd 03:34, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:39, 13 November 2005 (UTC)

[edit] Deluminati

Delete Unverifiable nonsense [15] PhilipO 00:01, 8 November 2005 (UTC)

  • Delete as an unverifiable collection of assertions looking for a reference. Sliggy 01:53, 8 November 2005 (UTC)
  • Delete hoax. Just zis Guy, you know? [T]/[C] :: AfD? 11:34, 8 November 2005 (UTC)
  • Delete all of the above, plus maybe OR --Rogerd 02:27, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:39, 13 November 2005 (UTC)

[edit] Digitaldreamdoor

nn website, alexa ranking of 73,589. User:Zoe|(talk) 00:52, 7 November 2005 (UTC)

  • Delete Advert. Flowerparty■ 01:47, 7 November 2005 (UTC)
  • Delete. Advert, not notable forum. *drew 02:48, 7 November 2005 (UTC)
  • Comment. I wouldn't be adverse to deletion. However, the site is used as a reference by a featured article. Of course, this doesn't really change anything. Deltabeignet 02:56, 7 November 2005 (UTC)
  • Delete as ad NSLE (讨论) \<extra> 08:32, 7 November 2005 (UTC)
  • Delete, even if it weren't advertising the site would be non-notable. Burn all adverts!- Just zis Guy, you know? [T]/[C] :: AfD? 18:55, 7 November 2005 (UTC)
  • Don't delete Digitaldreamdoor at all. What does a "not notable forum" have to do with anything? A forum is a forum. There's no justification that DDD is "non-notable" either. "Minor website or not", it is a significant tool online and very popular with Google.com. This is the only site that even tackles such lists which alone makes it unique. I guess this isn't a "free where anyone can edit" type of deal. Correct me if I'm wrong, but Wiki is supposed to spread info right? How many rules, etc., can you guys have? It's not like someone's posting garbage or a website that doesn't even exist. It's just one decent page--leave it alone and let it be.
    • Comment/Abstain. Because of the infinitely vast scope of the internet, along with the relatively limited space on the Wikipedia servers, it is agreed by many Wikipedia users that only websites with a significant user base or the sumject of mass media attention should be kept. There is an attempt to assemble aguideline at WP:WEB, which gives a list of criteria a website should meet to be included on Wikipedia. The website fails on two of the three counts in the current incarnation of the proposal; alexa rating of 73,000, and forum membership or roughly 2,000 users over five forums. Saberwyn 06:43, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:15, 13 November 2005 (UTC)

[edit] Doctor Trek

Non-notable fan fiction

  • Delete. Gazpacho 04:50, 7 November 2005 (UTC)

No significance to anyone other than its participants

  • Delete. Jasmol 04:53, 7 November 2005 (UTC)
  • Delete, fan-fiction is not notable. — JIP | Talk 06:26, 7 November 2005 (UTC)
  • Delete, agreed, fan-fiction is not notable. --Robby 15:30, 7 November 2005 (UTC)

Sounds cool. Keep it.--211.29.2.186 04:22, 9 November 2005 (UTC)Matt 9 November 2005

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:37, 13 November 2005 (UTC)

[edit] Dr.shockter

Band not found on allmusic.com, fails WP:MUSIC. 66.191.124.236 05:46, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP. Robert T | @ | C 03:36, 13 November 2005 (UTC)

[edit] Du Maurier (cigarettes)

Unencyclopedic; most text not really about Du Maurier Cigarettes anyway BeteNoir 23:39, 7 November 2005 (UTC). To clarify: I call this unencyclopedic because Wikipedia is not a directory of brand names. Articles must concern notable topics. BeteNoir 02:38, 8 November 2005 (UTC)

  • Delete as per nom. Eddie.willers 00:00, 8 November 2005 (UTC)
  • Keep. There are articles on several brands of cigarettes (Silk Cut, Superkings etc.); I do not see a difference between these brands and Du Maurier. I have re-written the article to try to make it more encyclopedic. Sliggy 01:46, 8 November 2005 (UTC)
  • Keep. I see no reason why this is unencyclopedic. Maxistheman 01:48, 8 November 2005 (UTC)
  • Keep. It may be breif, but it is still informative and encyclopedic. Tuckerekcut 02:56, 8 November 2005 (UTC)
  • Keep Cigarette articles don't cause brain cancer. Denni☯ 06:50, 8 November 2005 (UTC)
  • Keep notable Canadian brand of cigarettes.--Nicodemus75 07:02, 8 November 2005 (UTC)
  • Delete as WP:ISNOT a directory, and this article offers little else. Is this fagcruft, by the way? Just zis Guy, you know? [T]/[C] :: AfD? 11:26, 8 November 2005 (UTC)
  • keep and cleanup getcrunk juice 01:25, 9 November 2005 (UTC)
  • There's a whole category of Category:Cigarette brands; if those are encyclopedic enough, then so is this one. Keep, or establish policy against articles on cigarette brands. (I'd actually favour the latter, but in the absence of such a policy there's really no legitimate reason for this to be treated as somehow less notable than other brands.) Bearcat 23:29, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:01, 13 November 2005 (UTC)

[edit] Ekklesia Systems

Advertising for web-based application for Churches. Had flagged as copyvio, but editor claims permission. Don't see potential for expansion and notability looks doubtful (around 20 google hits) JJay 02:46, 7 November 2005 (UTC)

  • Delete per nom. --JJay 02:46, 7 November 2005 (UTC)
  • Delete per nom.--Alhutch 02:52, 7 November 2005 (UTC)
  • Delete. Seems like advertising to me. -Colin Kimbrell 17:11, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:34, 13 November 2005 (UTC)

[edit] Elite Authors Boards

Entry not relevantly factual or encyclopedic Hogo 22:56, 7 November 2005 (UTC)

  • Comment: Gaia=forum about RPing... not encyclopdic then either. It's just a community about RPing... nothing more than that.
  • Comment: this nomination was replaced with "nevermind" by Silva2022, one of the article's contributors. -- Kjkolb 00:30, 8 November 2005 (UTC)
  • Delete. Small Proboards-based board devoted to fanfiction = not encyclopedic on several levels. --Aquillion 00:33, 8 November 2005 (UTC)
  • Delete, the article says that it is a small website and it has about 250 members. -- Kjkolb 07:34, 8 November 2005 (UTC)
  • Delete non-notable (so kind of the author to point this out, I wish more vanity page authors were this considerate) Just zis Guy, you know? [T]/[C] :: AfD? 11:35, 8 November 2005 (UTC)
  • Delete NN --Rogerd 02:43, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:33, 13 November 2005 (UTC)

[edit] Erik Westlund

While the Joint Global Change Research Institute may be notable, it's webmaster is not. Possible Vanity.--JiFish(Talk/Contrib) 16:07, 7 November 2005 (UTC)

  • Delete per nom. Just zis Guy, you know? [T]/[C] :: AfD? 17:46, 7 November 2005 (UTC)
  • Delete for now. May be become more notable in the future, but for now it's a delete. Paolo Liberatore (Talk) 17:56, 7 November 2005 (UTC)
  • Delete per nom. BrianSmithson 18:21, 7 November 2005 (UTC)
  • Hey, I used to know that guy! Delete as non-notable all the same --keepsleeping say what 23:04, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:44, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedied as an attack. Ingoolemo talk 02:02, 8 November 2005 (UTC)

[edit] Eugene Hiscock

No claim of notability. Thue | talk 21:52, 7 November 2005 (UTC)

  • Speedy Delete. This article disparages an apparently NN subject. PJM 21:55, 7 November 2005 (UTC)
  • Delete and I'd say speedy as NN Bio and disparagement. - Just zis Guy, you know? [T]/[C] :: AfD? 22:05, 7 November 2005 (UTC)
I originally had it tagged as db-attack. PJM 22:08, 7 November 2005 (UTC)
  • Delete. Quote from article: He garnered just over seventy votes. He was asked in a political scrum if he was a serious candidate and he answered "NO". Punkmorten 22:12, 7 November 2005 (UTC)
  • Speedy delete as an attack page. -- Kjkolb 23:47, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE ♠PMC♠ 05:49, 14 November 2005 (UTC)

[edit] Exindfabrics

NN Company, seems more like an advertisement. Fallsend 09:27, 7 November 2005 (UTC)

  • Delete per nomination. - Fallsend 09:27, 7 November 2005 (UTC)

Relisting. Physchim62 (talk) 13:34, 13 November 2005 (UTC)

  • Delete per nom. -R. fiend 04:58, 14 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:32, 13 November 2005 (UTC)

[edit] Exotangerine

Prank. Information cannot be verified. Should be speedy but nominating just to be safe. Viriditas | Talk 11:33, 7 November 2005 (UTC)

  • Delete as hoax. Marskell 11:37, 7 November 2005 (UTC)
  • BJAODN, eh? fuddlemark (fuddle me!) 15:59, 7 November 2005 (UTC)
  • Delete. Hoax. Paolo Liberatore (Talk) 18:12, 7 November 2005 (UTC)
  • Delete Hoax abakharev 23:55, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:46, 13 November 2005 (UTC)

[edit] Fiction technique

Already transwiki-ed. Delete per WP:NOT brenneman(t)(c) 01:27, 7 November 2005 (UTC)

  • Delete per nominator. Wikibooks was clearly the appropriate choice. Superm401 | Talk 05:14, 7 November 2005 (UTC)
  • Delete per CSD:A5 Ingoolemo talk 08:16, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:30, 13 November 2005 (UTC)

[edit] Five mile limit

A spam for a completely non-notable Internet forum. Delete. - Mike Rosoft 22:47, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedy delete. Sjakkalle (Check!) 07:51, 7 November 2005 (UTC)

[edit] Formatdb

This is pointless article and Wikipedia's reputation has been affected at my forums because of it. Sabre 06:34, 7 November 2005 (UTC)

  • Speedy delete. Period. *drew 07:25, 7 November 2005 (UTC)
  • Speedy deleted. Absolutely patent nonsense. To give an idea of what the article contained I quote "atgttttgtcagtatgtacgagtgtcttacgacacaaaaccagatttact gctgcatctgatgacaaaggagtggcaactggagcttcccaagctgctca tctctgttcacggaggacttcaaaactttgagttgcagcccaaactaaag caagtcttcggcaaaggtcttataaaggctgcaatgactaccggagcctg". Sjakkalle (Check!) 07:51, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:48, 13 November 2005 (UTC)

[edit] Furry Perils

nn yahoogroup! membership of maximum 30. jnothman talk 01:45, 7 November 2005 (UTC)

  • Delete per nom. jnothman talk 01:45, 7 November 2005 (UTC)
  • Delete I can't imagine that any Yahoo! group is particularly notable — certainly this one isn't. Flowerparty■ 03:12, 7 November 2005 (UTC)
  • Delete Extraordinarily non-notable. Almost qualifies as a speedy (vanity) in my book. Turnstep 15:50, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete Jtkiefer T | @ | C ----- 05:52, 13 November 2005 (UTC)


[edit] Gabrielle Reilly

a vanity site, imo, though hotly disputed on discussion page. I think page should be put out of its misery

  • NOTE: I considerably reformatted and cleaned up this article (but did not delete much material). I don't know why I bothered to do this but I did. Anyway since people complained they couldn't figure out what the article was about, now they can. Herostratus 02:12, 12 November 2005 (UTC)
  • Delete, per nomFRS 23:55, 7 November 2005 (UTC)
  • Neutral. I've read the article, and can't figure out who or what she's supposed to be. She may or may not be notable, but there's no way to tell if -- or even for what -- she's notable. Vote subject to change, depending on clarification of basic issues. --Calton | Talk 00:13, 8 November 2005 (UTC)
  • Addendum: Okay, I started from first principles (reading the original stub) and working my way out from there, and it looks like badly written vanity, with a string of minor achievements that don't add up to much. Delete. --Calton | Talk 06:07, 10 November 2005 (UTC)
  • Geeze this looks like a fun one. From what I can tell, she has been involved to various degrees in some poltiical campaigns that didn't really do much, and is was involved in publicity for Sprint at some conference... uh... not really seeing the notability here, certainly nothing to warrant such a lengthy article. Also, her site has an Alexa rank of 175,444. Delete --W.marsh 00:18, 8 November 2005 (UTC)
  • Weak Delete She gets 45,700 Google Hits see [16] but she doesn't quite cross the line of notability for mine yet despite the campaign to re-elect John Howard. Capitalistroadster 00:32, 8 November 2005 (UTC)
    • BTW, who has nominated this deletion. I will change my vote to neutral given the lack of a nominator. Capitalistroadster 00:37, 8 November 2005 (UTC)
      • It was nominated by FRS who cast the first vote. --W.marsh 00:52, 8 November 2005 (UTC)
yes, 'twas me--FRS 01:10, 8 November 2005 (UTC)
  • Note: This debate has been included in the list of Australia-related deletions. . Capitalistroadster 00:35, 8 November 2005 (UTC)
  • Delete. Vanity; appears to be just some random staffer. Ambi 01:05, 8 November 2005 (UTC)
  • Delete. This article's 1,387-word length is way out of proportion to subject's notability, which is quite small despite mini-achievements in politics, self-promotion, and bikini modeling. betsythedevine 01:32, 8 November 2005 (UTC)
  • Delete per betsythedevine. And nom too, but betsythedevine said it better. ;) Ifnord 06:20, 8 November 2005 (UTC)
  • comment There is no reason a less-significant subject can't be full featured-article length. Length of article should be proportional to the amount of information contained in it, not to the notability of the subject. --Scott Davis Talk 08:39, 8 November 2005 (UTC)
    • Yeah, length is a reason to cleanup, not delete, but I think people are just commenting because they're annoyed that they wasted their time reading 1,400 words of pure fluff before voting. --W.marsh 14:57, 8 November 2005 (UTC)
  • That said, I vote delete on this article unless someone can clean it up to the standard where we can at least understand why Gabrielle Rielly might be notable. This rambling article gives Wikipedia a bad name in its current form. If the article is improved to describe claim to notability in the first paragraph, please disregard this vote. --Scott Davis Talk 08:39, 8 November 2005 (UTC)
  • Delete vanity. Agree with Betsythedevine - notability not established and this has vastly too much detail for a general encyclopaedia even if she were notable; for example, anyone who wants a list of the countries she has visited (i.e. virtually nobody) can visit her website. Just zis Guy, you know? [T]/[C] :: AfD? 11:31, 8 November 2005 (UTC)
  • Speedy delete A7. "If the assertion is disputed or controversial, it should be taken to AFD instead." Well, as others have noted, there's no assertion there to begin with! Seems like a perfect candidate. pfctdayelise 12:40, 8 November 2005 (UTC)
  • Comment After reading her website and bit of googling, it appears to me that her 15 minutes of fame was to promote Howard in a bikini during the last election. (Does anyone remember seeing this (WMV file) on the tv? It's subtle, huh?) Unsurprisingly the NT Libs lapped her up and apparently one of them nom'ed her for Young Aus of the Year, and wanted to make her an American tourism ambassador or something similar. If this article is to be kept, then this event seems to be the only really significant event. All the info about her website and modelling is definitely extraneous. pfctdayelise 13:03, 8 November 2005 (UTC)
  • Delete vanity, non-notable. Wikipedia is not a soapbox -- Ian ≡ talk 02:12, 9 November 2005 (UTC)
    • Comment - that at least 4 of the editors to this article have edited it and basically nothing else - User:64.126.94.1, User:137.186.252.246, User:Bull Buster, User:Investigator -- Ian ≡ talk 02:39, 9 November 2005 (UTC)
  • Delete rubbish!, vanity! non-notable! horrible, even! Agnte 16:49, 9 November 2005 (UTC)
  • Delete Non-notable, vanity, psycho legal-type supported. --InShaneee 00:56, 10 November 2005 (UTC)
  • Delete nn vanity page. Dottore So 11:04, 11 November 2005 (UTC)
  • Keep. Only because I did so much work on cleaning it up. Also, I'd hit it. Herostratus 02:12, 12 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedy delete under A7, as any and every assertion of notability is obviously false, or some other speedy criterion (take your pick). - ulayiti (talk) 01:26, 7 November 2005 (UTC)

[edit] Geoffrey Camanzo

Pretty amusing article, but should be in Uncyclopedia or something. Definitely shouldn't belong here. 207.207.127.240 00:29, 7 November 2005 (UTC)

  • Delete. I read on the village pump that there's a speedy delete tag for articles like this. Does every article have to go through an articles for deletion vote? Pintele Yid 00:42, 7 November 2005 (UTC)
  • Delete - a definite hoax. Pl. BJAODNify. I think it cd have been speedied under patent nonsense, I may be wrong though. Anyways, since an anon IP has listed it here, let's discuss it here. I guess it'd get closed pretty soon anyways. --Gurubrahma 00:45, 7 November 2005 (UTC)
It could've been speedied under G3 for silly vandalism. I'm taking it to BJAODN, sad to know that it is un-Uncyclopedic ;)--Gurubrahma 00:53, 7 November 2005 (UTC)
  • It's not funny enough for Uncyclopedia. Ironically, Uncyclopedia has guidelines on the difference between just plain silliness and actual humour. This article is in the former category. Unverifiable rubbish. Delete. Uncle G 00:45, 7 November 2005 (UTC)
  • Delete. Possible G3 category for "silly vandalism" as defined under Wikipedia:Vandalism. I quote our definition: Users will sometimes create joke articles or replace existing articles with plausible-sounding nonsense, or add silly jokes to existing articles (this includes Mr. Pelican Shit.) A better place for content that is intentionally of a joking or nonsensical nature is the Uncyclopedia." I consider that this article meets the silly vandalism category and doubt that it is funny enough for Uncyclopedia. Capitalistroadster 01:02, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was keep. Kirill Lokshin 00:41, 13 November 2005 (UTC)

[edit] Harissa

Already transwiki-ed, no posibility for expansion to encyclopedic entry. Also Harrisa, although that's technically the auspice of WP:RfD. Delete brenneman(t)(c) 01:12, 7 November 2005 (UTC)

  • Keep, I think it could be a decent article like couscous... but, it surely shouldn't be a recipe. gren グレン 02:12, 7 November 2005 (UTC)
    • I'll change my opinion if that happens, of course. And before anyone protests, I know AfD isn't speedy cleanup, I just don't think there's an article here. Of course, I would have said the same thing about Ham and cheese sandwich and look how well that turned out...
      brenneman(t)(c) 02:29, 7 November 2005 (UTC)
      • I agree, and yet disagree. I am just typically of the viewpoint that an article that could deserve an article should be able to keep one, as long as it's not wrong. Your viewpoint is completely legitimate, and, I just hope mine is too :) gren グレン 17:49, 7 November 2005 (UTC)
  • Keep, this seems an interesting article, which would be worth developing (fabrication methods, economy, main producers and brands, possible uses, etc...). I think this is an important item in France and north African countries. Hektor 04:26, 7 November 2005 (UTC)
  • Keep currently a good little stub with potential for expansion. Capitalistroadster 05:26, 7 November 2005 (UTC)
  • Keep has potential, no need to delete. — Wackymacs 07:56, 7 November 2005 (UTC)
  • Comment I can't help but notice that no one is actually improving this article. - brenneman(t)(c) 09:46, 7 November 2005 (UTC)
    • And? Are you going to go round all the other stubs on Wikipedia and nominate them for deletion too? — Haeleth Talk
      • I have added it to Wikipedia:Requests for expansion, what is to say someone here wont be improving it soon? — Wackymacs 16:57, 7 November 2005 (UTC)
        • No need to be testy. This nomination was made as part of the transiki process. I'm commenting on the fact that people are saying that this can be expanded, but it's not expanding. Normally, an article would actually be expanded during the AfD. It hasn't, not a single edit. That's all. - brenneman(t)(c) 17:21, 7 November 2005 (UTC)
  • Keep. Common ingredient deserves real article. African product counters systemic bias. — Haeleth Talk 16:43, 7 November 2005 (UTC)
  • Keep per Capitalistroadster, Haeleth. Perodicticus 16:52, 7 November 2005 (UTC)
  • Keep Trollderella 19:39, 7 November 2005 (UTC)
  • Keep. Valid encyclopedia subject. Cnwb 22:34, 7 November 2005 (UTC)
  • Strong Keep, encyclopedic description of culturally and culinarily significant foodstuff. MCB 22:15, 9 November 2005 (UTC)
  • Comment Here is the change in this article since the tag applied: [17]. - brenneman(t)(c) 23:03, 9 November 2005 (UTC)
  • And that's a reason to delete it? Just because nobody has improved it yet doesn't mean it will never be improved. Besides, look at the Wikibooks cookbook entry for Harissa, it's empty and you're not complaining about that. If you really want to improve the article (you seem eager to), you can nominate it for COTW since it's a stub, or improve it yourself. — Wackymacs 07:38, 10 November 2005 (UTC)
  • I'm not screaming for this article's blood or anything. (Although I'm sure it would be deliciously spicy!) I nominated this procedurally, as I said before. I just think that it's really odd that no one has made the slightest improvement. Don't you think that's weird at all? - brenneman(t)(c) 07:49, 10 November 2005 (UTC)
  • No, I don't think it's weird. I couldn't contribute anything to an article about calculus, but I know the topic's important enough to have an entry. I haven't edited the harissa article because I don't know enough about North African/Middle Eastern cooking; however, I do know that harissa is a very important condiment in those cuisines, probably equivalent to Worcestershire sauce or garam masala (both of which have entries). I would guess that only a tiny proportion of editors on Wikipedia have seen this AFD; just because none of us could improve the article doesn't mean that nobody can. Perodicticus 08:28, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was keep revised article. - Mailer Diablo 08:54, 13 November 2005 (UTC)

[edit] History of Chatham Islands numismatics

Looks like original research. Fallsend 02:36, 7 November 2005 (UTC)

  • Delete per nomination. - Fallsend 02:36, 7 November 2005 (UTC)
  • Huh? Delete. Signed essays like this are usually original research. -R. fiend 05:48, 7 November 2005 (UTC)

Yes,this is original research.It has been an ongoing project since late 2003. -User:Aidan Work

  • Comment. And therefore not for Wikipedia. See What Wikipedia is not, Section 1.3. - Dalbury (talk) 18:04, 7 November 2005 (UTC)
  • Delete per WP:NOR.--Isotope23 19:54, 7 November 2005 (UTC)
  • Delete as original reasearch, per WP:NOT. Paolo Liberatore (Talk) 20:00, 7 November 2005 (UTC) Made some more edits. Now it's a Keep. Paolo Liberatore (Talk) 16:16, 8 November 2005 (UTC)

I have had some very good reviews from people in the numismatic trade over here in New Zealand.It has been accepted for publication in an issue of the Coin News,which is published by Token Publishing,England.I haven't been told when it will be published,but it will eventuate. - User:Aidan Work

  • Delete - original research. If this gets published and is kept, it's a copyvio. Bjelleklang - talk 00:45, 8 November 2005 (UTC)

Bjelleklang,it would not be a copyright violation,because as the author,I have the moral & legal right to reproduce the article. -User:Aidan Work

If Aidan is the copyright owner, then hence he can GPL or anything he likes to it. If it gets published in a magazine, and Aidan states that it has never been published before, then that is a problem, but for Aidan/Magazine, not for wikipedia. Similarly Aidan cannot give the magazine total exclusive copyright, as Aidan would already have GPL'ed the wiki version. Again that is a problem for Aidan, not wiki. Best that he inform the magazine at time of submission. Sumburgh 09:04, 8 November 2005 (UTC)
  • Add source-based research references and Keep: The article has not been wikified, needs to be tidied, esp. a space character after punctuation marks. It needs more cross reference to source of information to ensure it is genuine information. If it has these, then it seems reasonable that the page is allowed.
The current guidelines are: Wikipedia:No_original_research#What_is_original_research
Original research that creates primary sources is not allowed. However, research that consists of collecting and organizing information from existing primary and/or secondary sources is strongly encouraged. In fact, all articles on Wikipedia should be based on information collected from primary and secondary sources. This is not "original research," it is "source-based research," and it is fundamental to writing an encyclopedia.
There is dedication: "Dedicated to the memory of the late W.H.(Bill) Lampard" which I am not sure is allowed, maybe in the talk page??
There is some self promotion: "Aidan Work was born in Wanganui,New Zealand on the 23rd of November 1976.He has been an active numismatist", which could be dropped, but my initial feeling is that the bulk of this article is actually fact. Quoting source document, and source news paper article would help confirm this feeling.
There are many other similar articles of "original content" without any kind of reference to and "existing primary and/or secondary source" eg. The town of Grutness in the Shetlands. The only thing that distinguishes Aidan article it that it is longer then normal, any has been contributed without being wikified. It is mostly gathered facts and data.
Given that Aidan is a clearly a first time wiki contributor, what say we give him a hand get the data he has gathered into an "source-based research" acceptable form. Lets not shoot him down on his first major contribution.
Sumburgh 09:04, 8 November 2005 (UTC)
  • Keep I'm with User:Sumburgh on this this. Part of the problem here is that Aidan has self-identified this as 'original research'. That threw me at first. I think he is using research in the sense of 'literature search', and didn't know of the use in What Wikipedia is not. He appears to have built this article from primary sources, which is rare in Wikipedia, and to be encouraged. - Dalbury (talk) 11:00, 8 November 2005 (UTC)
  • Keep - I agree. This is a very little-known subject, but is worthy of an article if written properly. It may even be that Aidan Work is the world expert on the subject. However, the article needs to be written in a Wikipedia-0friendly (i.e., encyclopaedic) way (One minor point BTW - the article that Sumburgh mentions did have an external source: a map showing the place mentioned. I have now added a second one - ironically from a page on Sumburgh). Grutness...wha? 11:19, 8 November 2005 (UTC)
  • Strong keep. I would prefer the "original research" from WP:NOT to get renamed to "original speculation," which seems to me to go to the heart of the matter. Articles on encyclopedic subjects are not disqualified just because their author includes research he got from primary sources. This seems to be an encyclopedic, if obscure, subject; and Wikipedia is not paper. Smerdis of Tlön 16:06, 8 November 2005 (UTC)
  • Keep. Needs some tidying, some pictures etc, but that makes it a candidate for Peer review, not AfD.-gadfium 18:23, 8 November 2005 (UTC)
  • Keep'. Rename as Chatham Island numismatics, rewrite it to good encyclopedic standard, enhance presentation with a couple of pics, and this could be a good entry in Wiki. Also, I agree with User:Ihcoyc|Smerdis of Tlön. Moriori 19:17, 8 November 2005 (UTC)
    • Comment I agree for the move (after the AfD is closed). Paolo Liberatore (Talk) 20:52, 8 November 2005 (UTC)
  • Keep and move to Chatham Island numismatics, as above. I don't see any speculation engaged here; further references required. Josh Parris # 04:20, 9 November 2005 (UTC)
  • It has to be kept as 'History of Chatham Islands numismatics',as there are no longer any coins or banknotes being issued for the Chatham Islands.Besides,the name 'Chatham Island' is the name of the largest island,which is where the settlements of Waitangi & Owhenga are. - (Aidan Work 06:12, 9 November 2005 (UTC))
    • Comment. Typically, we have articles on History of X only if we also have articles on X. The fact that the Chatham Islands are not issuing any other notes is not important here. Note also that the numismatics is the study of money; the title history of numismatics therefore means the history of the study of money of the Chatham Islands, while the article is on the history of money of the Chatham Islands. Paolo Liberatore (Talk) 11:29, 9 November 2005 (UTC)
  • keep and move to Chatham Islands currency including adding info on when the islands started using New Zealand money (as they do now) BL kiss the lizard 05:51, 10 November 2005 (UTC)
    • Comment. My understanding from the article is that the Chatham Island currency was issued alongside NZ currency, although that perhaps could be clarified. - Dalbury (talk) 11:49, 10 November 2005 (UTC)
  • Keep per the reasoning of Smerdis of Tlön. Myself, I have always interpreted 'original research' as applying to either either an individual's subjective interpretation of a thing/event or the results of a first-hand experiment that haven't been subject to peer review. This doesn't fit either one. It's pretty much impossible to write a truly encyclopedic article on a subject without citing primary sources, so banning that practice would be self-contradictory (and asinine). -Colin Kimbrell 17:08, 10 November 2005 (UTC)

I did directly mention that the Chatham Islands notes were issued to circulate along with New Zealand currency. - (Aidan Work 05:01, 11 November 2005 (UTC))

  • Are you crazy? This is a great article.
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy delete (A2). Physchim62 (talk) 13:37, 13 November 2005 (UTC)

[edit] Hot buttered rum

Has been transwikied, no encyclopaedic content. Ingoolemo talk 08:09, 7 November 2005 (UTC)

  • Currently no info on cultural significance (if any). Delete because wikipedia is not a recipebook. Jacqui ★ 06:30, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:13, 13 November 2005 (UTC)

[edit] Hubert Saint-Onge

Resumé. Doesn't meet WP:BIO. 66.191.124.236 04:35, 7 November 2005 (UTC)

  • Delete per WP:VAIN; the phone number and email at the bottom tells everything... Paolo Liberatore (Talk) 19:18, 7 November 2005 (UTC)
  • Delete vanity/advert FRS 01:31, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. - Mailer Diablo 08:58, 13 November 2005 (UTC)

[edit] Idlewells Shopping Centre

See the previous discussion at Wikipedia:Articles for deletion/Idlewells Shopping Centre.

Originally, the article was speedily deleted. It was recreated and speedy deletion was rejected this time. *Useless content. Delete unless rewritten. - Mike Rosoft 21:39, 7 November 2005 (UTC)

  • Converted to a factual stub and I still vote delete because it is plainly not in any way notable. - Just zis Guy, you know? [T]/[C] :: AfD? 22:22, 7 November 2005 (UTC)
  • Delete, WP:NOT a directory. --Aquillion 00:37, 8 November 2005 (UTC)
  • Keep but clean up. I'm in the middle of doing this at the moment - I would appreciate help! Some people like deleting articles that are poorly written rather than rewriting them.--[[User:4836.03|User:4836.03 Oh yeah! i am cool!]] 19:23, 8 November 2005 (UTC)
  • That's not the objection (or we'd just tag for cleanup and get on with our lives). The problem is that you have not made any attempt to establish why this particular shopping centre is notable. You are free to add it on the releavnt town article if you think it deserves some kind of mention, but please do try ot keep the tone neutral and encyclopaedic. - Just zis Guy, you know? [T]/[C] :: AfD? 12:57, 11 November 2005 (UTC)
  • Delete NN --Rogerd 03:11, 10 November 2005 (UTC)
  • Delete non-notable mortar. Dottore So 11:08, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was dealt with as copyvio. - Mailer Diablo 08:56, 13 November 2005 (UTC)

[edit] Infotronics UK

Reads like ad copy. 99% certain this is spam to one degree or another. TexasAndroid 14:42, 7 November 2005 (UTC)

  • Copyvio from [18]. Not sure if this qualifies for a speedy under A8, so I will follow the most conservative route and list it at WP:CP. Sjakkalle (Check!) 15:19, 7 November 2005 (UTC)
  • Comment: You're correct. It doesn't qualify, as they are providing services for money, not selling the content that has been copied. -- Kjkolb 16:22, 7 November 2005 (UTC)
  • Delete advert. 'burn all adverts! Just zis Guy, you know? [T]/[C] :: AfD? 17:50, 7 November 2005 (UTC)
  • Delete advert --Rogerd 03:45, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Redirect to Ultimate (sport). Physchim62 (talk) 13:41, 13 November 2005 (UTC)

[edit] Intense Disc

See the discussion at Wikipedia:Articles for deletion/Intense frisbee of the identical article. That was a near consensus save for the keep vote by Trollderella (who did leave comments towards retracting keep vote on my usertalk page).—Gaff ταλκ 07:56, 7 November 2005 (UTC)

  • Delete as near identical article to the previously deleted Intense Frisbee. Saberwyn 23:48, 7 November 2005 (UTC)
  • Redirect to Ultimate frisbee. Denni☯ 06:26, 8 November 2005 (UTC)
    • There is no ultimate frisbee article, delete.--nixie 06:28, 8 November 2005 (UTC)
    • It's Ultimate (sport), due to trademark issues concerning use of the word frisbee. Saberwyn 06:30, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 13:43, 13 November 2005 (UTC)

[edit] Janet Jackson trivia

Wikipedia is not a collection of trivia. Merge all useful contents to Janet Jackson, if any; otherwise, delete. - Mike Rosoft 16:33, 7 November 2005 (UTC)

  • Merge with Janet Jackson. Capitalistroadster 17:10, 7 November 2005 (UTC)
  • Delete this comprehensively uninteresting trivia. Oh, merge it if you must. Just zis Guy, you know? [T]/[C] :: AfD? 17:15, 7 November 2005 (UTC)
  • Delete. I can't be bothered to read the entire boring Janet Jackson article to see what's there already, but if anything's not mentioned, well, no big loss, really. -R. fiend 17:41, 7 November 2005 (UTC)
  • Delete per nom. Merge content is ok, but do not leave redirect: merge means that a redirect is leaved in place of the merged article; Uncle G, am I correct? Paolo Liberatore (Talk) 17:55, 7 November 2005 (UTC)
  • Delete per nom. PJM 19:02, 7 November 2005 (UTC)
  • Merge and Delete per nomination. - 160.5.237.99 19:17, 7 November 2005 (UTC)
Whoops - 160.5.237.99 is me. Curse of the random log-out. mholland 19:23, 7 November 2005 (UTC)
  • Merge only useful content JFW | T@lk 01:38, 8 November 2005 (UTC)
  • Merge all useful content --JAranda | watz sup 01:24, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was NO CONSENSUS. — JIP | Talk 09:33, 13 November 2005 (UTC)

[edit] Jean-Claude Irvoas

Individual is not notable; Wikipedia is not a memorial Dhartung | Talk 08:32, 7 November 2005 (UTC)

  • Keep or Merge. The individual has been the first victim of 2005 Paris suburb riots and as such, it has some historical notability. I can happily agree about merging it with the main article on riots. --Cyclopia 10:17, 7 November 2005 (UTC)
  • Keep. Historic event. First casualty of the riots, this article may have significant historical significance and implications. Keep, it will most likely be expanded with more information as that information is gained. --michaelg
  • Delete or Merge to 2005 Paris suburb riots. Media coverage should not automatically grant a subject notability beyond the associated event. Dottore So 12:03, 7 November 2005 (UTC)
  • Delete per nomination. It is grossly biased to keep this here when casualties of police assaults aren't given the same attention. —Preceding unsigned comment added by 205.211.168.10 (talk • contribs) 2005-11-07 14:50:46 (UTC)
    • This vote has no signature, so it can't be valid. However the reasons behind it would be right, if only there are news of casualties due to police assaults, but I can't find any info about it. --Cyclopia 15:31, 7 November 2005 (UTC)
      • This is not true. Read the guidelines: "Unregistered and new users are welcome to contribute to the discussion". In other words, you don't need an account to vote here (but it helps). — Haeleth Talk
  • MERGE it makes no sense to keep this as a separate stub, the information is scant, and is currently only appropriate for the larger entry on the riots. the person who supported deletion because "police casualties aren't given the same attention" is obviously an idiot. in fact, casualties of POLICE are the ONLY statistics that are compiled and reported. there's no information (or "attention") available anywhere for casualties of rioters or innocent bystanders. that's just a fact. secondly, the charge of "bias" makes absolutely no sense considering that the man was killed by muggers or rioters. this person is obviously a knee-jerk reactionary who has trouble sleeping at night when the misfortunes of AUTHORITY figures aren't loudly trumpeted, during any mention whatsoever of anybody's suffering, for everyone to grieve over. 128.119.132.42 16:14, 7 November 2005 (UTC)
    • Can we avoid flaming, please? And remember only people with a WP account can vote, AFAIK? --Cyclopia 21:59, 7 November 2005 (UTC)
      • Not true that an account is needed: see above. — Haeleth Talk
        • Ouch! Sorry. I remember times in which things were different, and I didn't have read the policy,recently (I don't agree with non-logged users voting btw, but that's way OT now). --Cyclopia 00:18, 8 November 2005 (UTC)
  • *Keep or Merge. as per --CyclopiaFRS 22:25, 7 November 2005 (UTC)
  • Merge per Cyclopia. — Haeleth Talk 23:15, 7 November 2005 (UTC)
  • Keep. We have an article on Crispus Attucks, which seems to set the precedent. - Dalbury (talk) 00:58, 8 November 2005 (UTC)
  • Delete Wikipedia is not a memorial. This person is otherwise non-notable. Denni☯ 06:34, 8 November 2005 (UTC)
  • Keep or Merge. Was mentioned yesterday by Prime Minister Dominique de Villepin during his national television address Here is the reference. Hektor 21:36, 8 November 2005 (UTC)
    • Comment. Sometimes just being a victim is enough to make you notable. I point again to Crispus Attucks. - Dalbury (talk) 22:29, 8 November 2005 (UTC)
      • "Martin Luther King, Jr. referred to Crispus Attucks in the introduction of Why We Can't Wait as a specific example of a man whose contribution to history has been overlooked by standard histories." I doubt Irvoas will ever have someone as noteworthy as King to call his name before his peers. Denni☯ 04:56, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:44, 13 November 2005 (UTC)

[edit] Jeff Prouty

Apparent nonsense/hoax article CH (talk) 01:19, 7 November 2005 (UTC)

  • Delete Can't verify claim in article, found someone named Jeff Prouty via Google but he doesn't seem notable. --W.marsh 02:50, 7 November 2005 (UTC)
  • Delete as per nom. Deltabeignet 03:01, 7 November 2005 (UTC)
  • Delete, current contents are useless. It doesn't tell us what he has invented. — JIP | Talk 06:24, 7 November 2005 (UTC)
  • Delete as per above. NSLE (讨论) \<extra> 08:34, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Keep (not an AfD matter). Physchim62 (talk) 13:47, 13 November 2005 (UTC)

[edit] John McCollum

Page created with misspelled last name; has been moved to John McCallum (strength training writer) Dsreyn 23:18, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:29, 13 November 2005 (UTC)

[edit] Jon Hames

Delete. Bio article on college student who is apparently an activist, but not yet warranting an encyclopedia article. Other related article include Leah Sanderson and UQ Union—Gaff ταλκ 07:19, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was userfy. – Alphax τεχ 14:41, 7 November 2005 (UTC)

[edit] Jon-o Gadecki

Vanity page. User appears to be editing as Pizzajono (talk · contribs) and Gamespotter (talk · contribs). Userfy and delete. Viriditas | Talk 12:46, 7 November 2005 (UTC)

  • Speedy delete surely there's no claim of notability here... jnothman talk 14:11, 7 November 2005 (UTC)
  • Speedy userfy, on the assumption it's not deleted as A7 before I finish typing this sentence. I'll handle it (with help from a helpful admin). fuddlemark (fuddle me!) 14:37, 7 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete Jtkiefer T | @ | C ----- 05:55, 13 November 2005 (UTC)


[edit] Joona Palaste

Nom & vote Del on this vanity page which (apparently) is on & by n-n WP admin.
--Jerzy•t 19:50, 7 November 2005 (UTC)

  • Delete, non-notable - this is really a bit confusing, as JIP should know better. Was this posted in jest? BD2412 T 20:21, 7 November 2005 (UTC)
  • Delete, Not notable bio. Fallsend 20:54, 7 November 2005 (UTC)
  • Delete per BD2412. Actually, this should be an A7 speedy. —Ilmari Karonen (talk) 21:20, 7 November 2005 (UTC)
  • Weak delete, Joona Palaste gets over 6000 Google hits (most of them archives of his Usenet posts to programming newsgroups). Used to be fairly notable among the Amiga fandom community but probably not any more. — JIP | Talk 09:04, 8 November 2005 (UTC)
    • Having lots of Google hits is not sufficent for notability. "Ilmari Karonen" gets about 11,800 hits, for much the same reasons. Nonetheless, I see no reason to start an article about myself unless I actually accomplish something encyclopedic. —Ilmari Karonen (talk) 11:55, 8 November 2005 (UTC)
      • Are you sure they're all about the same Ilmari Karonen? "Joona Palaste" is a much rarer Finnish name than "Ilmari Karonen". — JIP | Talk 12:22, 8 November 2005 (UTC)
        • To my knowledge there is only one person going primarily by the name Ilmari Karonen alive today. All those hits do appear to be about me. (Correction: I found one page referring to my uncle by his full name and four pages (all dead links now, alas) referring to someone named Ari Ilmari Karonen. So that'd make it about 11,795 hits. ;-)) —Ilmari Karonen (talk) 12:51, 8 November 2005 (UTC)
  • Keep This is although a niche and a stub, about nonetheless a living person some one who has an effect on a fair amount of people and therefore is worthy of note. Just because someone is behind the scenes and lack international aclaim doesnt make them less notable. so if we are judging on percieved notablility are we not judging celbrity, The acter may act but the stage crew make him who he is. User: Rob15v (comment actually by 217.44.195.40 (talk · contribs)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 15:11, 13 November 2005 (UTC)

[edit] Karaoke Badboy

Nonnotable performer, vanity article, see also The Badboy, Delete. Dvyost 07:33, 7 November 2005 (UTC)

  • Delete Google search for "Karaoke Badboy" gave me just two sites that mention/link to his site (and some false hits). - Dalbury (talk) 00:42, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:27, 13 November 2005 (UTC)

[edit] Kiwiblog

Fairly popular blog in New Zealand but not notable enough. Author may fall just below level of biographical inclusion but perhaps a merger into a "David Farrar" article might work. SimonLyall 11:10, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:25, 13 November 2005 (UTC)

[edit] Lakeside Park Day

non notable imaginary holiday BeteNoir 23:27, 7 November 2005 (UTC)

  • Delete as per nom. Eddie.willers 23:40, 7 November 2005 (UTC)
  • Delete non-notable (and even if it wasn't it could be included in the article on Rush) Just zis Guy, you know? [T]/[C] :: AfD? 11:13, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 02:30, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:25, 13 November 2005 (UTC)

[edit] Lango (ecolect)

  • Nothing on google. Not sure what this is, but it should be speedy delete (even though it is fairly well-written and has a NPOV. ) Joaquin Murietta 06:42, 7 November 2005 (UTC)
  • Delete but not speedy--this is non-notable, but that's not a speedy criterion yet. Didn't turn anything up on Google myself and was on my way to list it here. --Dvyost 06:48, 7 November 2005 (UTC)
  • Delete per nom. Added a note to the author's talk page encouraging him to keep contributing to Wikipedia, though. --William Pietri 07:45, 7 November 2005 (UTC)
  • Delete, original research. —Ilmari Karonen (talk) 00:23, 8 November 2005 (UTC)
  • Delete as NN. - Dalbury (talk) 00:24, 8 November 2005 (UTC)
  • Delete. The sentence Lango is spoken by a handfull of people in specific areas of the United States. makes it NN in my opinion. Bjelleklang - talk 00:25, 8 November 2005 (UTC)
  • Delete nn or hoax JFW | T@lk 01:32, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete Jtkiefer T | @ | C ----- 23:25, 13 November 2005 (UTC)

[edit] Laszlo Panaflex

nn Simpsons character only mentioned twice in a single episode PoptartKing 02:26, 7 November 2005 (UTC)

  • Delete. Not even a character; just part of a joke. (And only mentioned once, that I can recall.) HollyAm 02:34, 7 November 2005 (UTC)
  • Delete per nominator, and I love the Simpsons. Superm401 | Talk 04:16, 7 November 2005 (UTC)
  • The entry explains the joke, providing the link between Laszlo Kovacs and the Panaflex camera. Keep it. 63.18.44.224 04:22, 7 November 2005 (UTC)
    • Wikipedia is not The Simpsons Archive. We do not need an article explaining every one-liner on television. HollyAm 04:35, 7 November 2005 (UTC)

*Delete. I was the author of the page, and have already merged the info onto my user page. Laszlo Panaflex 05:08, 7 November 2005 (UTC)

  • If anyone goes searching for Laszlo Panaflex, they are most likely to be directed to my user page, where the information has already been merged, inclduing the links to Laszlo Kovacs, Panavision, and IMDB. I initially included the info here because it took me a while to figure out who or what the name referred to, and figured I could save someone else the trouble. With the info on my user page, that should be enough.
Otoh, Laszlo Panaflex is also the name of a Euro-beat dance band that had a big hit called "Dance to the Music" in 2002. http://www.beatport.com/artist/Laszlo+Panaflex If that information is added to the page, does it become a Keeper? Laszlo Panaflex 20:30, 7 November 2005 (UTC)
  • Keep - Page updated to reflect new research that does not really belong on my User page. Laszlo Panaflex 23:07, 7 November 2005 (UTC)
  • Comment - I've edited the page to concentrate on the band, mostly removing the material on the Simpsons character (which is already present in his bullet on the List of characters from The Simpsons). I'm not sure whether the band in question is notable or not, but as the article in question is now about a completely different thing, it should probably be re-listed. They have a page on Allmusic, and while I can't find evidence of their single charting, it's possible that I'm not looking in the right place. -Colin Kimbrell 16:56, 10 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was has been deleted as nn-bio. Ingoolemo talk 05:33, 7 November 2005 (UTC)

[edit] Leah Sanderson

Delete. Biography material on active member of University student union member. No apparent need for inclusion in encyclopedia —Gaff ταλκ 05:20, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 14:12, 13 November 2005 (UTC)

[edit] List of factual inaccuracies of the book Angels and Demons

This is simply not a valuable list. It was originally used in Angels and Demons itself, where it served only to prejudice people against the book. After I removed it from that page, Hektor made it its own page. However, the content is unjustifiable there too. Encyclopedias are not meant to have every detail possible, but rather only address the most important issues. A list of factual inaccuracies in Angels and Demons is open-ended, POV, and clearly inconsistent with other fiction articles. "Wikipedia is not an indiscriminate collection of information". Superm401 | Talk 04:10, 7 November 2005 (UTC)

  • I know I cannot vote since I am the creator of the article, although I didn't write its contents, but only tried to preserve its contents for discussion. Please see Talk:Angels and Demons for an explanation of the genesis of this article.Hektor 04:08, 7 November 2005 (UTC)
You didn't even let me finish nominating it. Superm401 | Talk 04:10, 7 November 2005 (UTC)
Sorry, I am not familiar with the procedure.Hektor 04:29, 7 November 2005 (UTC)
That's all right. Superm401 | Talk 04:36, 7 November 2005 (UTC)
  • There is no reason that authors cannot vote in this date especially if they are registered users. Our guidelines for Articles for Deletion say "If you are the primary author or otherwise have a vested interest in the article, say so openly, and clearly base your recommendations on the deletion policy." Capitalistroadster 04:29, 7 November 2005 (UTC)
    • In this case Keep or Merge with article Angels and demons. This is valuable content and research worth keeping on many interesting topics. And - by the way - I was looking for this kind of information (after having read the book) when I first tried to access the article Angels and demons of Wikipedia.Hektor 04:31, 7 November 2005 (UTC)
  • Delete It is pointless, for one very important reason: Angels and Demons is a work of fiction. Therefore, historical inaccuracies should be expected and are not notable enough for an article. Cynicism addict 05:38, 7 November 2005 (UTC)
    • I think that inaccuracies are important when they are so blatant that they prevent the suspension of disbelief necessary for the enjoyment of a work of fiction.Hektor 05:59, 7 November 2005 (UTC)
      • All fiction has historical and other inaccuracy. The type that has the most is known as fantasy. Many people find it easiest to suspend disbelief when reading this genre, so your point is doubtful. Furthermore, we would need a source to show that it prevents the enjoyment of the work. Right now, it seems that's your opinion, making it unacceptable. original research. Superm401 | Talk 06:22, 7 November 2005 (UTC)
        • "we would need a source to show that it prevents the enjoyment of the word" -- WTF? WTF does enjoyment of the work have to do with this? -- Antaeus Feldspar 22:03, 7 November 2005 (UTC)
  • Delete sillyness. Any major glaring mistakes might be usefully merged with the Angels and demons article, but these are incredibly petty for a work of fiction. Bikeable 06:57, 7 November 2005 (UTC)
  • Delete. A database of all factual inaccuracies in all works of fiction might be an interesting project, but it's a different project than this one. --William Pietri 08:12, 7 November 2005 (UTC)
    • Transwiki to WikiBooks. Based on UncleG's comments below, I'm changing my vote. --William Pietri 04:43, 8 November 2005 (UTC)
  • Delete agreeing with above. If a particular inaccuracy is relevant to the book, list it in the work's main entry. Dottore So 11:57, 7 November 2005 (UTC)
  • Delete - this list does not belong on Wikipedia, it is just a collection of niggling points that are irrelevant, bearing in mind the book is indeed a novel and thus assumed to be a work of fiction, with non-facts and inaccuracies. Mushin 15:22, 7 November 2005 (UTC)
  • Delete - this is not Wikipedia material (WP:NOT). Per nom. --Robby 15:29, 7 November 2005 (UTC)
  • Keep, or merge back into the main article, removing the more niggling points. Given that it's commonly assumed that Dan Brown's books are technically accurate (last time I glanced at a rack of them in my bookshop, there was a sign saying "based on real historical facts!"), it is certainly not POV to point out a few examples of glaring mistakes in them. Sorry, but it absolutely is encyclopedic. Far more so than all the pokecruft that there's a clear consensus to keep. — Haeleth Talk 19:01, 7 November 2005 (UTC)
If we're the ones noting the inaccuracies, it sounds like original research to me. Since other people already maintain lists like this I think we're better off linking external resources from the main Angels and Demons article. --William Pietri 19:47, 7 November 2005 (UTC)
  • Delete. If anyone believes those "based on real historical facts" signs by the kiosk for his books, pop me an email... I've got a special deal on super valuable, invisible, intangible diamonds I'm looking ot unload. Kidding aside though, as pointed out above this is a work of fiction. There is no logical reason to post lists of the factual inaccuracies about every book/movie. Otherwise we end up with 100 lists about how there would never be enough gravity on that asteroid they land on in Empire Strikes Back for them to walk around, etc... If anyone is so inclined to add a couple of the more glaringly silly things from the book to the main article I certainly am not going to revert, but all things considered, hopefully the average reader understands that "fiction" means "made up".--Isotope23 20:34, 7 November 2005 (UTC)
  • Merge back to main article. It is not relevant except in context of the book but in that context it is very relevant and I can't imagine how we could justify not including it. Certainly not with the reasoning that all our readers should know it's baloney and take it with a grain of salt; there is a world of difference between trusting people to understand that there are no real-life Wookiees and trusting people to spot that Dan Brown translated Novus Ordo Seclorum incorrectly to lend false support to certain conspiracy theories. -- Antaeus Feldspar 21:55, 7 November 2005 (UTC)
    • There's nothing wrong with pointing out that there are a number of factual errors. It is even appropriate to delineate some of the more serious ones, like that mistranslation. However, the list is clearly not appropriate for an encyclopedia article. That is why UncleG has moved it to Wikibooks(see below). Superm401 | Talk 23:41, 8 November 2005 (UTC)
      • Do you mean "not appropriate as its own encyclopedia article" or "not appropriate for as an encyclopedia article"? If it's the latter, I'm afraid you'll have to explain why you believe this. -- Antaeus Feldspar 17:58, 9 November 2005 (UTC)
  • Merge as per Antaeus Feldspar and Haeleth - I'd suggest trimming it to the most pertinent and least nitpicky examples, though, to prevent it overwhelming the other article. So, a paragraph on main errors (groups such as 'physics', 'history', 'geography', etc.) rather than a list? Ziggurat 22:39, 7 November 2005 (UTC)
  • Delete Oh my, Isotope23, are you sure there isn't enough gravity on that asteroid they land on in Empire Strikes Back for them to walk around? We should have an article, called Gravity errors in Star Wars movies, for sure... oh yeah. KillerChihuahua 00:51, 8 November 2005 (UTC)
    • Heh, I'll get right on writing that.  ;) --Isotope23 03:55, 8 November 2005 (UTC)
  • Keep or merge as extremely useful - yes, I expect this kind of thing from Wikipedia too. --Malyctenar 14:27, 8 November 2005 (UTC)
  • I suggest the mechanism that we have commonly employed before to satisfy both those who want sourced encyclopaedia articles and those who want detailed textual and plot analysis: an encyclopaedia article about the book on Wikipedia, an annotated text wikibook on Wikibooks, and shiny interwiki links joining them both together. I've set up the Angels and Demons wikibook for you. Uncle G 00:45, 8 November 2005 (UTC)
    • Thanks a lot. I think that this idea solves the issue, while allowing to preserve the information currently in this article. Once again, I didn't create this article for it to stay, but to make sure that the preservation of its contents is at least discussed and possibly ensured.Hektor 01:27, 8 November 2005 (UTC)
    • I don't care much as long as it's off Wikipedia. But to be frank, isn't this the kind of thing they complain about us dumping over there? It doesn't seem like it would fit well into a larger book, or that it could become one of its own ...Superm401 | Talk 01:45, 8 November 2005 (UTC)
You may be right that this is appropriate on Wikibooks. However, it is not an annotated text. It couldn't be, because according to Wikibooks, annotated texts must contain the text and Angels and Demons is still very much in copyright. Superm401 | Talk 23:41, 8 November 2005 (UTC)
  • Delete a list of factual inaccuracies in a work of fiction? Come on.  Grue  17:58, 9 November 2005 (UTC)
  • Delete There has to be a limit to "lists of" stuff, and I think this is kinda over the line. If the innacuracies are relevant enough, they should be mentioned in the article for the book itself. Otherwise, I don't think we need this as an article. --DanielCD 20:03, 9 November 2005 (UTC)
  • Delete; unencyclopedic list of trivia about a fictional work that belongs on a fan site, not on Wikipedia. MCB 22:22, 9 November 2005 (UTC)

Comment: The article is currently available at wikibooks:Angels and Demons/Divergence from reality. Physchim62 (talk) 14:12, 13 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result was No consensus ~ trialsanderrors 01:07, 15 November 2006 (UTC)

I was asked to provide a reasoning behind my decision, so here goes: 1. If I count !votes I get roughly 21 dels, 13 keeps, that's a 60% majority for deleting, but really in no man's land between no consensus (ca. 50%) and rough consensus (ca. 67%). 2. The policy on WP:NOT is very much in flux over whether glossaries are exemptions to the Not a dictionary provision. Unless there is consensus to strike the exemption I prefer to stick with the status quo ante (still reflected in Wikipedia:Lists (stand-alone lists)), which is that glossaries are acceptable. 3. Most importantly, the content of the article changed significantly in the last days of the debate [19] thanks mostly to edits by User:JJay, and this change was reflected in a number of delete→keep changes and late keep !votes, so the early "delete not sourced" !votes are no longer on solid factual ground. Taking these three factors into account I did not see that consensus for deletion was established. This is a no consensus closure though so it can be renominated anytime. I recommend waiting three to four weeks for the policy debate to be settled and to see if the article improves, and consider renomination then. But of course I might be wrong, and that's what we have WP:DRV for. ~ trialsanderrors 22:25, 15 November 2006 (UTC)

[edit] List of Japanese sex terms

List of Japanese sex terms (discussion|history|protect|delete|undelete|logs|links)

This list contains Japanese terms for sex, sex organs, sex positions, and so on. Wikipedia is not a dictionary. We should not be hosting random lists of foreign words. Although we do have some lists like this, unlike those there's no particular reason to maintain a list of sex terms in various languages, since sex-related articles on English Wikipedia are written in English, and those that are specifically on Japanese sex topics define all the terms they use. Exploding Boy 06:58, 9 November 2006 (UTC) Erm. Delete, obviously.

  • Delete. This article is inherently unverifiable. We have no way of knowing if these definitions are accurate. If anywhere, it belongs on the Japanese Wikipedia. Even then it is not encyclopedic. These are not unique concepts, such as might find in a glossary, they're just definitions of crude words in a foreign language. -Will Beback 08:12, 9 November 2006 (UTC)
    I don't understand why you call this inherently unverifiable. why would this be any less verifiable than american sex terms? Derex 10:38, 9 November 2006 (UTC)
  • Delete. I fail to see any merit in this ever-growing list of foreign language sex-slang. It fails what Wiki is not, so I'm suprised it's managed to stay up for so long. At best this article is an unverifiable list of foreign language slang with minimal use as any kind of reference point, and at worse it's just acting as a bulletin board for people to post titillating rude words from Japan. ShizuokaSensei 08:31, 9 November 2006 (UTC)
  • Delete as per ShizuokaSensei, its not what Wikipedia is. James086 Talk | Contribs 14:09, 9 November 2006 (UTC)
  • Keep sourced, encyclopaedic. No comprehensible rational for deletion advanced (as far as I can see, all arguments are either a)factually wrong or b)essentially "I don't like it, for no particular reason". WilyD 15:03, 9 November 2006 (UTC)
    • Please be civil. If you would like to explain precisely why the claim that Wikipedia is not a dictionary applies is "factually wrong", someone might be willing to listen to you. Merely asserting that those who oppose you are making "incomprehensible", "irrational", "factually wrong", and unsupported claims is inappropriate. — Haeleth Talk 09:51, 10 November 2006 (UTC)
      • Uh - this is clearly not a dictionary entry. Thus wikipedia is not a dictionary doesn't apply. There's zero plausible basis for even trying to assert it's a dictionary entry. Clearly it's a stub or start class list - but being a stub is hardly a criterion for deletion. It's hard to aruge that it's not a dictionary entry because there's no argument to be made - a cursory visual inspection reveals it not to be. WilyD 14:51, 10 November 2006 (UTC)
  • Delete and salt - How on God's green earth can you claim this is encyclopedic??! It does NOT meet WP: NOT. It is NOT VERIFIABLE in that there are no SOURCES. Bishōjo has no sources. Futanari is not sourced. Image club is just totally made up. I would strongly suggest that the people voting keep THINK about what they are voting to keep. There are some terms in the list that are legit, but the majority of list is an unsourced list of mostly unsourced terms that , if they belong ANYWHERE, belong on the Japanese Wikipedia. Please also look up in the dictionary the definition of encyclopedia. Wikipedia is not toilet paper. --Shrieking Harpy Talk|Count 15:46, 9 November 2006 (UTC)
    • I said it's encyclopaedic because it is. I said it's verifiable because it is. This seems like a fairly straightforward proposition - I'm not sure how you missed it. WilyD 18:14, 9 November 2006 (UTC)
Really, folks, you gotta love inclusionists. Alright , let's examine:
  1. If you are using the definition of encyclopedic as "an alphabetical organization of fields of knowledge" then you are being pedantic. It is not suitable for inclusion in an encyclopedia, no matter how much it tries to fit a dictionary definition of encyclopedic. It is not a collection of verifiable facts. If you are saying that it is, then I respectfully think you are wrong and agree to disagree.
  2. If you are suggesting that articles, without sources, that are little more than stubs, that have existed in the same state for months, are verifiable, do you mean theoretically? Because, theoretically, anything is verifiable to some people. But it is not verifiable in terms of WP:V for a very large majority of terms on that list. --Shrieking Harpy Talk|Count 18:46, 9 November 2006 (UTC)
Okay, apart from being demonstratably not an inclusionist (I've compared my AfD votes and it's pretty clear I'm a "centrist" on the issue - my keep arguments for articles that are deleted are a percentage of my keep arguments that equal to the percentage of my delete arguments where the article is kept) I'll show what the problem is when you vote to delete an article without first reading it.
If an article is appropriate for an encyclopaedia, but not for "the spirit of an encyclopaedia" then voting to delete it clearly fails WP:NPOV. Rather than make value judgements about whether I particularly like a topic or not, I apply Wikipedia, she ain't paper and ask merely "Is it encyclopaedic?" - here even you admit the answer is yes, so I'll move on.
I'll ask is it sourced? For this article, the answer is yes - clearly it's important to read the article to determine whether or not it's sourced. Merely guessing can result in the wrong answer. Being sourced (such as this article is) brings the advantage of a vaguely NPOV test of notability - someone else has found it notable enough to document - this is (I believe) a much more NPOV test than Do I personally find this article interesting? WilyD 14:47, 10 November 2006 (UTC)
  • Delete - In addition to the problems we see alot with lists we also have the fact that WP is not a dictionary, not a slang archive. The article lacks sources and is unverifiable. -- wtfunkymonkey 16:45, 9 November 2006 (UTC)
  • Keep, things like "image club" are verifiable if anyone could be bothered to try; encylopedic. Kappa 17:00, 9 November 2006 (UTC)
I'd just like to note that people aren't providing reasons for their "keep" votes. It's not enough to say it's encyclopaedic, particularly when so many have argued that it's inherently unencyclopaedic. While items on the list may be verifiable, that still doesn't provide a convincing rationale for keeping the list itself, as mentioned in the original post. Exploding Boy 17:05, 9 November 2006 (UTC)
The justification for keeping the list is that it explains a variety of encylopedic topics grouped in an obvious way. Kappa 17:32, 9 November 2006 (UTC)
But it doesn't. It's just a list of non-English terms. All the Japanese sex-related articles should already appear in List of sexology topics, and every article that uses Japanese terminology should already be explaining those terms within the article. Exploding Boy 17:37, 9 November 2006 (UTC)
Yes it does. List of sexology topics doesn't explain anything, are you suggesting we add the explanations there? Kappa 18:01, 9 November 2006 (UTC)
  • Delete. May well be verifiable, but shouldn't be here: belongs in a dictionary, not an encyclopedia. WMMartin 17:49, 9 November 2006 (UTC)
  • Delete Wikipedia is not a slang dictionary, or even a regular dictionary. A big list of words and definitions beside them is called a dictionary. Slang is not only hard to cite, but it also means different things in different areas/eras. Also this is an english encyclopedia, so an article that primarily carries foreign langauge is not suited here. Not encyclopedic. HighInBC (Need help? Ask me) 18:12, 9 November 2006 (UTC)
  • Keep if sources can be found. Singapore sexual slang terminology looks to me like a good example of what this article could be. I wonder why most of the articles linked to from this list aren't in Category:Sexual slang. —Wrathchild (talk) 19:33, 9 November 2006 (UTC)
    • Note. The artilce has had a "source request" tag up for the last three weeks. Apparently no addiitonal sources are available. -Will Beback 00:40, 10 November 2006 (UTC)
  • Delete as per nomination. Xdenizen 22:02, 9 November 2006 (UTC)
  • Delete per all the Delete votes. This is Wikipedia, not Sugoipedia (sou desu ne :P). Danny Lilithborne 22:26, 9 November 2006 (UTC)
  • Transwiki to Wiktionary, then Delete. ···日本穣? · Talk to Nihonjoe 22:52, 9 November 2006 (UTC)
  • Keep per precedent per Wrathchild. Carlossuarez46 23:28, 9 November 2006 (UTC)
  • Keep a precise list of terms on a given specific subject is authorized by policy. Terms such as bukkake, gokkun etc. are extremely well known and verifiable through tons of sources. I don't even understand the objection on that score. The nom seems to be questioning the raison d'etre of this list. Well, for better or worse, Japan and sex have been tightly intertwined in the western imagination since at least the 19th century. The interest in Japanese erotica is thus not new and is today a serious subject for critical examination and scholarship [20]. The vast popularity of specific Japanese porn genres in the west is just a later-day manifestation of the previous craze for Japanese erotic prints. Given the cultural divide, it is entirely appropriate for wikipedia to maintain a list of this type for its mainly English speaking readers. --JJay 23:54, 9 November 2006 (UTC)
  • Comment Every term is either in or not in a dictionary; those that are in dictionaries are obviously verifiable. Verifiability is not an issue. Fg2 01:21, 10 November 2006 (UTC)
  • Delete is not a dictonary. Arbusto 03:17, 10 November 2006 (UTC)
  • Delete (1) Dicdef. (2) What's verifiable already has its own article. Everything else is unverifiable. (3) This is another of many cases where a "List of..." should be a category. There already is Category:Japanese sex terms even in the article itself, so this list is redundant -- not to mention they're harder to maintain. Anomo 03:23, 10 November 2006 (UTC)
    • So this list of foreign language terms with explanations is redundant with an incredibly useful list of foreign language terms without explanations? Kappa 09:43, 10 November 2006 (UTC)
  • Strong keep per the reasoning in the previous VfD. Useful list that points to useful articles, inherently encyclopedic and so on.  Grue  08:39, 10 November 2006 (UTC)
  • Delete per Anomo. -- Hoary 09:16, 10 November 2006 (UTC)
  • Strong delete per official Wikipedia policy: Wikipedia is not a dictionary.
    Note that the list is also rather inaccurate. It might be better titled List of random Japanese words that some otaku think might sometimes be associated with sex. How the hell are "bishōjo" and "bishōnen" sex terms? (And in what parallel universe does anyone use the word "bishōjo" by itself to refer to eroge?) How is "dōjin" a sex term, given that dojin works are no more exclusively pornographic than Western vanity publications are? — Haeleth Talk 09:47, 10 November 2006 (UTC)
Comment. Amen to that. ShizuokaSensei 10:12, 10 November 2006 (UTC)
AfD is not a place for content concerns. That's why there's an edit button. WilyD 14:48, 10 November 2006 (UTC)
True, but let it be noted that a major cleanup on this list was only done after the list was AFDd. Exploding Boy 19:38, 10 November 2006 (UTC)
The lesson here is, never attempt to clean up an article after it goes on AFD. Kappa 04:44, 11 November 2006 (UTC)
  • Delete per nom; encyclopedia =/= dictionary. Angus McLellan (Talk) 11:37, 10 November 2006 (UTC)
  • Delete. I don't understand how anyone can argue this is encyclopædic. It is a list of foreign words with definitions. Additionally, Haeleth is absolutely right about it being a very Western-otaku-biased "article" with very little Japanese language comprehension: even as a dictionary article it is not very good. The onus of explaining the individual terms should be on the individual articles, as linked-to from the Japanese Sex Terms category. Finally, do the 'keepers' not see the redundancy, all other arguments aside, of a "list of japanese sex terms" article within the overall category "Japanese sex terms"? Erk, 1345, 10 November 2006 (GMT-8).
    • For those not following the discussion, how is a list of defined foreign language terms redundant with a list of undefined foreign language terms? Kappa 04:41, 11 November 2006 (UTC)
  • Delete. This iscnot what wikipedia is for.
  • Weak Keep Presuming the terms can be verified. Given that for some of the terms we have extensive articles on them it isn't unreasonable to have a list of all the highly notable Japanese sexual terms. The only issue is that it might make more sense as a subcategory of sexual slang rather than as a list. JoshuaZ 04:57, 11 November 2006 (UTC)
  • Delete Unverifiable list. JASpencer 09:31, 11 November 2006 (UTC)
  • Per WP:V, if you can't source it, delete it. Sources cited, so change to a keep. Seraphimblade 01:01, 12 November 2006 (UTC)
  • Delete. Wikipedia is an encyclopedia. Wiktionary is a dictionary. -- Stbalbach 06:41, 12 November 2006 (UTC)
  • Keep - I am not sure how this list is any more or less unencyclopaedic than any other list on wikipedia. How is this any different from the List of gay slang words and phrases, the List of films that most frequently use the word fuck, etc...The terms are all verifiable, there is ample precident for this kind of lists, or lists in general. If people think this list should be deleted, then the opinion should hold that 100% of lists should be deleated, as they are all equally unencyclopaedic.MightyAtom 01:14, 13 November 2006 (UTC)
List of gay slang words and phrases is at least defensible on the grounds that the terms are in English. As for the other article.... it's been AFDd at least 5 times. Exploding Boy 18:29, 13 November 2006 (UTC)

So I checked as to why that list survived. "Like other 'lists of trivia', they are interesting and not detrimental to the encyclopedia." Seems like that could apply here as well. It is all verifiable info. Its interesting. Seriously, what is the point of lists at all, anyways? None of them are "unencyclopaedic." Delete this one, delete them 100%. MightyAtom 00:49, 14 November 2006 (UTC)

    • Has it occured to you that those articles may be just as deserving as deletion as this one? After all Wikipedia is not subject to precident.(actually the list of films with the word fuck is very well sourced, but is not a dictionary list) HighInBC (Need help? Ask me) 01:16, 13 November 2006 (UTC)
    • Comment Agree with HighInBC's comment. I can't find a thing to verify most of these terms, but if they're easily verifiable, cite sources and I'll happily change votes! The main sticking point here is the lack of verifiability, so at least to my thinking, fix that and the whole issue goes away. Seraphimblade 01:32, 13 November 2006 (UTC)
  • Weak keep. The books "Japan's Sex Trade" and "Japanese Street Slang" by Peter Constantine can verify some of these, but dictionary issues?... Pete Fenelon 01:54, 13 November 2006 (UTC)
  • Delete and transwiki to Wiktionary, if they want it. It's not sourced and Wikipedia is not a dictionary. The cleaned up version of the page is just as invalid as the full version (which would have been better material for Wiktionary.) The cleaned up version consists of a list of links to other articles in the project. There's no need for that. Inclusion of other articles is not an indicator of notability. --Kunzite 05:24, 13 November 2006 (UTC)
    • Comment. If this list is going to survive, what is listed on it needs to be very closely monitored. The fact so little of this article's definitions are unique to Japan is a big part of the problem with it. Very little of what was listed is unique to Japan - it simply defines a Japanese word for something which goes on all over the world. This is a deeper problem with Wiki wearby numerous topics of little or no note are documented in great depth, but let's not get into that here. So, what is of note out of the article? Just up to H, I'd argue that at least half of what is currently there is not in anyway unique to Japan and merely serves as a DicDef.
      • Bukkake: A Japanese invention - worthy of inclusion
      • Chikan: Not unique to Japan - of little note. However, has a long and meandering article (lifting large sections from Rotton.com as a source) suggesting otherwise...
      • Ecchi: Links to the article for the English letter H. A foreign slang word for sex - of little note
      • Enjo kosai: The Japanese term for underage prostitution - at a strech worthy of inclusion
      • Futanari: Japanese for hermaphrodites - of little note
      • Fuzoku: Defined as meaning "sex culture" in Japanese Doesn't have an article. Of little note.
      • Gokkun: A genre of Japanese porn. Worthy of inclusion
      • Hentai: Defined as "pervert." This is a much wider part of sex culture, so worthy of inclusion

Any thoughts?ShizuokaSensei 07:46, 14 November 2006 (UTC)

  • Delete per WP not a dictionary. Eusebeus 12:37, 14 November 2006 (UTC)
  • Strong keep -- I voted to delete this before, but I've changed my mind, because the article is in different shape now. Wikipedia is not a dictionary, but these are not simply translations of English phrases into Japanese but rather a completely different beast: sociological phenomena of sexuality in Japan, explained, and with articles about (most of) them. This could maybe use a renaming of some kind, but this list is cut down to the essentials and is encyclopedic. See Wikipedia:Lists (stand-alone lists) and you'll see that this kind of list is much like other kinds of lists given there. I can't help but think that many of the people who endorse deletion under the dictionary argument haven't noticed these points, but rather noticed the "list of ... terms" and didn't like the article concept. So like I said, maybe renaming is a good idea, but I'm not sure to what. Still, this goes well beyond mere "terms." Mangojuicetalk 19:39, 14 November 2006 (UTC)
  • Changing to Keep per changes indicated by Mangojuice and others, above. I think it is now definitely encyclopedic and fits the guidelines indicated on Wikipedia:Lists (stand-alone lists). ···日本穣? · Talk to Nihonjoe 20:43, 14 November 2006 (UTC)
  • Keep its sourced.  ALKIVAR™ ☢ 00:55, 15 November 2006 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete.  Denelson83  04:47, 12 November 2005 (UTC)

Some leftover articles were in Cat:CSD. They have been now removed. --AllyUnion (talk) 12:04, 16 November 2005 (UTC)

[edit] List of music videos by name

Am I missing something here? As far as unmaintainable, pointless song lists go, this really has to take the cake. There's been a fair amount of deletions of song lists recently, and many I really had no opinion on, but this one just sort of astounds me. Where to begin? First of all, this is not a list of music videos, but really a list of songs that have music videos. And basically every popular song released in the last 25 years has had some sort of video made for it (and many earlier ones have had videos thrown together from concert footage and the like as well). We used to have a List of songs by name that was poised to try to include every song ever recorded. Saner minds prevailed, and it now lists only songs that have articles. I wouldn't be opposed to treating this the same, but the problem exists that we don't have articles on music videos (that I know of, perhaps there's a few exceptions), we have articles on songs that may have music videos. If anything, the video is mentioned in the song article. Turning this into a list of songs that have articles in which the music videos are described or mentioned seems completely pointless too. I just don't see a sane way of salvaging this. It would be basically "Popular songs since 1981" and would have all the problems List of songs by name used to have. -R. fiend 06:10, 7 November 2005 (UTC)

  • Delete per nomination. --Metropolitan90 06:28, 7 November 2005 (UTC)
  • Delete per nomination. --Edwardian 06:46, 7 November 2005 (UTC)
  • Delete per nom. Flowerparty■ 14:43, 7 November 2005 (UTC)
  • Delete per nomimation. --Robby 15:34, 7 November 2005 (UTC)
  • Delete per nomination. Gaius Cornelius 17:40, 7 November 2005 (UTC)
  • Delete. Like he said. --Calton | Talk 00:29, 8 November 2005 (UTC)
  • Delete - massive waste of time. JFW | T@lk 01:30, 8 November 2005 (UTC)
  • Delete with suggestion: articles with information about music videos in them could be tagged with a category (if that's not happening already). Jacqui ★ 06:23, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:21, 13 November 2005 (UTC)

[edit] List of songs recorded in both fast and slow versions by the same artist

Unmaintainable list. Too subjective - exactly what constitutes a "fast" or a "slow" version? And how many songs were recorded at two different speeds by the same artist, and how do you verify that information? Delete. - Mike Rosoft 19:20, 7 November 2005 (UTC)

  • del. Nonnotable and vaguely defined distinction. mikka (t) 19:41, 7 November 2005 (UTC)
  • Delete per nom. Not to mention that this is a list with two entries. And, how about a list of songs that where recorded at three different speeds? Paolo Liberatore (Talk) 20:02, 7 November 2005 (UTC)
  • Delete listcruft. Might merit a passing mention in an article on musical tempo, but that's about it. Just zis Guy, you know? [T]/[C] :: AfD? 22:30, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:35, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 15:12, 13 November 2005 (UTC)

[edit] List of songs with lyrics modified for usage in ad campaigns

More song listcruft. Exactly how are we going to maintain or verify this information? Delete. - Mike Rosoft 20:59, 7 November 2005 (UTC)

  • Delete probably the single most pointless piece of listcruft this month Just zis Guy, you know? [T]/[C] :: AfD? 22:27, 7 November 2005 (UTC)
  • Delistify, merge and redirect to Music in advertising, which could use some help anyway. Jacqui ★ 06:38, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:35, 10 November 2005 (UTC)
  • Keep as useful trivia since music mods are somewhat common in ads. I'm gonna add more to it. --SuperDude 02:02, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Merge to List of University of Maryland, College Park people. Physchim62 (talk) 14:21, 13 November 2005 (UTC)

[edit] List of University of Maryland, College Park alumni

list duplicates Category:University of Maryland, College Park alumni, every person on list with own article is listed in category

  • Delete; per nomination. -James Howard (talk/web) 18:15, 7 November 2005 (UTC)
  • Delete per nomination. --Robby 19:08, 7 November 2005 (UTC)
  • Keep list, merge with other UofM people lists, and delete the categories instead. Annotated lists, sorted according to academic discipline or area of activity/work, are far better for this type of information than categories. u p p l a n d 20:18, 7 November 2005 (UTC)
I disagree that they are better. Some people may exist as alumni of multiple institutions. Therefore, adding them to multiple alumni categories allows that to be cross-references (and, if working with a data dump, analyzed) much more freely. -James Howard (talk/web) 20:45, 7 November 2005 (UTC)
  • Keep Categories are not annotated, this list is. The category gives no indication of why the people in it are notable. Also the list includes several notable people who do not yet have articles, making this list a useful development tool per Wikipedia:Lists. Dsmdgold 22:12, 7 November 2005 (UTC)
  • Keep. Categories and lists are not mutually exclusive, see Wikipedia:Categories, lists, and series boxes. And there are plenty of similar lists in Category:Lists of people by university affiliation - USA. The more common technique, however, seems to be to create List of University of X people, so these three should probably be merged into a List of University of Maryland, College Park people. Flowerparty■ 22:23, 7 November 2005 (UTC)
  • Merge if we must have listcruft let's have just the one. But the definition of notable seems to differ form the normal Wikipedia one. Just zis Guy, you know? [T]/[C] :: AfD? 22:32, 7 November 2005 (UTC)
  • Delete, the category is sufficient and doesn't encourage the creation of articles on non-notable alumni. -- Kjkolb 23:32, 7 November 2005 (UTC)
  • Rename per Flowerparty. --Vsion 00:42, 8 November 2005 (UTC)
  • Keep and Rename as per Flower. --Nicodemus75 07:00, 8 November 2005 (UTC)
  • Keep and Rename as per Flower. --tomf688{talk} 05:21, 13 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Merge to List of University of Maryland, College Park people. Physchim62 (talk) 14:21, 13 November 2005 (UTC)

[edit] List of University of Maryland, College Park faculty

List served by Category:University of Maryland, College Park faculty

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Merge to List of University of Maryland, College Park people. Physchim62 (talk) 14:22, 13 November 2005 (UTC)

[edit] List of University of Maryland, College Park notable others

List is kind of useless. Everyone on this list is in Category:University of Maryland, College Park

  • Delete; per nomination. -James Howard (talk/web) 18:37, 7 November 2005 (UTC)
  • Delete; Per Nom. --Robby 19:10, 7 November 2005 (UTC)
  • Keep list, merge with other UofM people lists, and delete the categories instead. Annotated lists, sorted according to academic discipline or area of activity/work, are far better for this type of information than categories. u p p l a n d 20:24, 7 November 2005 (UTC)
  • Keep Dsmdgold 22:15, 7 November 2005 (UTC)
  • Keep' / merge See Wikipedia:Articles for deletion/List of University of Maryland, College Park alumni. Flowerparty■ 22:30, 7 November 2005 (UTC)
  • Merge if we must have listcruft let's have just the one. But the definition of notable seems to differ form the normal Wikipedia one. Just zis Guy, you know? [T]/[C] :: AfD? 22:32, 7 November 2005 (UTC)
  • Delete, the category is sufficient and doesn't encourage the creation of articles on non-notable others. -- Kjkolb 23:32, 7 November 2005 (UTC)
  • Merge per Flowerparty. --Vsion 00:43, 8 November 2005 (UTC)
  • merge this too please Yuckfoo 01:18, 8 November 2005 (UTC)
  • Keep/merge as above.--Nicodemus75 07:01, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:36, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:50, 13 November 2005 (UTC)

[edit] List of Zatch Bell! Spells

This is essentially a vast image gallery of unsourced, presumably copyrighted, images with no licence information, combined with one-liner descriptions. This does not appear to be an encyclopedia article in the generally accepted sense. Delete -- The Anome 02:03, 7 November 2005 (UTC)

  • Delete. A pity because a lot of work went into it, but it is just another unencyclopaedic list. Copyvio too no doubt. Moriori 02:12, 7 November 2005 (UTC)
  • Delete Wikipedia is not a mirror or a repository of links, images, or media files --anetode¹ ² ³ 02:15, 7 November 2005 (UTC)
  • Delete as WP:NOT an image gallery with the images, and as exceedingly overspecific fancruft without the images. - A Man In Black (conspire | past ops) 04:35, 7 November 2005 (UTC)
  • Oh good lord no! Delete. Post-haste! -R. fiend 05:38, 7 November 2005 (UTC)
  • Keep but remove copyvio images.I'm not familiar with whatever is being discussed there, but surely we can delete the images and keep the text? - Mgm|(talk) 08:26, 7 November 2005 (UTC)
    • This is a list of all the various spells used in the Zatch Bell anime. It's possible one could make a list of the recurring spells in that anime, but this list doesn't offer a useful foundation for that task, and even that list would be bordering on fancruft. - A Man In Black (conspire | past ops) 18:14, 7 November 2005 (UTC)
      • It should also be pointed out that every single (presumably copyvio) image on this page seems to also be used at Zatch Bell! characters, an article with many of the same problems. --Aquillion 01:10, 8 November 2005 (UTC)
  • Delete, listcruft... no encyclopedic context.--Isotope23 17:35, 7 November 2005 (UTC)
  • Delete. - Foofy 15:33, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:20, 13 November 2005 (UTC)

[edit] Lloyd Hercek

bio of a member of a non notable...google returns zero hits, currently looking for record deal jfg284 22:34, 7 November 2005 (UTC)

Comment: The Charlie Bryant Tribute Band, his non-notable band, is also up for deletion.

Delete per nomjfg284 22:34, 7 November 2005 (UTC)

  • Delete for failure of WP:MUSIC guidelines. Eddie.willers 23:49, 7 November 2005 (UTC)
  • Delete non-notable member of non-notable band. Just zis Guy, you know? [T]/[C] :: AfD? 11:37, 8 November 2005 (UTC)
  • Delete NN2 --Rogerd 02:56, 10 November 2005 (UTC)
  • Delete zero google hits. vanity, advertising.-Dakota t e 03:11, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was NO CONSENSUS. — JIP | Talk 12:20, 13 November 2005 (UTC)

[edit] Loogie

Unnecessary, somewhat disparaging, uninformative(unsigend nom by User: 68.105.125.20)

  • Keep. Loogies, although disparing, are a phenomena with verifiable history, as this stub alludes.—Gaff ταλκ 07:40, 7 November 2005 (UTC)
  • Delete, without the original research, it would be a dictionary definition. -- Kjkolb 13:12, 7 November 2005 (UTC)
  • Keep. Gross, but a part of the natural world. 14:13, 7 November 2005 (EST)
  • Delete dicdef of a slang term, plus a lot of UE material FRS 22:18, 7 November 2005 (UTC)
  • Keep. Google gets 224 hits on the phrase "loogie hawking". I don't like it, but it is in use. - Dalbury (talk) 00:32, 8 November 2005 (UTC)
  • Comment: Here is part of the article: "As with so many anti-social acts, this feeling of power must be re-inforced frequently, before the aftershock of depression sets in as the perpetrator realizes the futility of his/her deed, and ultimately of life. Traditional places where anti-social people 'hock' loogies are bridges, tall buildings, subway platforms, office urinals, and wilderness trails- places which are symbolically more elevated than the perpetrator." It makes a lot of dubious claims, but offers no proof. Without this type of material, it would be a dictionary definition. -- Kjkolb 00:54, 8 November 2005 (UTC)
  • keep please there are 93,300 googles for this even [21] Yuckfoo 01:21, 8 November 2005 (UTC)
  • Delete, I put it up for deletion. It's a dictionary slang definition with quite a bit of unnecessary and antagonistic commentary inserted. The tone of elitism just kind of set me the wrong way.(FireballX301 03:09, 8 November 2005 (UTC))
  • Redirect to Phlegm. I'm sure there are some people who only know the term "loogie" but not the proper medical term. --Metropolitan90 05:59, 8 November 2005 (UTC)
  • Delete Once this article loses its POV, its original research, and its generally snotty attitude, it's pretty much just a dicdef. Denni☯ 06:17, 8 November 2005 (UTC)
  • While I believe the article topic is encyclopedic (or at least Wikipedic), once we purge what's here of POV, unsourced material, and how-to, there won't be much left. Therefore, redirect to phlegm per Metropolitan90 for now. If someone wants to go back and write a sourced, encyclopedic article about loogies later, I would certainly support them. Jacqui ★ 06:26, 8 November 2005 (UTC)
  • Keep Fairly informational as far as its topic goes, it's also quite entertaining, and provides insight as to the psychology of those who hock loogies. Tratos 04:18, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:36, 13 November 2005 (UTC)

[edit] MapMyRun

nn website, advertising. User:Zoe|(talk) 00:29, 7 November 2005 (UTC)

  • Delete. Pintele Yid 00:40, 7 November 2005 (UTC) (preceding comment moved from MapMyRun by Flapdragon 00:45, 7 November 2005 (UTC))
  • Delete, or possibly a redirect to... uh, something. I'm not familiar with the field, but aren't "track how far I run" devices like this called something (other than GPS)? Whatever they are, that might be a good spot to redirect this one. -- Captain Disdain 00:49, 7 November 2005 (UTC)
  • Redirect to pedometer. Superm401 | Talk 05:10, 7 November 2005 (UTC)
  • Delete per nom. jnothman talk 14:31, 7 November 2005 (UTC)
  • Delete non-notable concept, I think this is already an option on heart rate monitors anyway so I question whether it will ever achieve notability, especially since the poor-man's GPS is now low-cost GPS. - Just zis Guy, you know? [T]/[C] :: AfD? 18:56, 7 November 2005 (UTC)
  • Redirect. No valid reason given for deletion, nonetheless, this does not look independently verifiable. Trollderella 19:24, 7 November 2005 (UTC)
    • I do believe Trollderella is spamming AfD with canned responses. User:Zoe|(talk) 03:06, 8 November 2005 (UTC)
  • Delete. Personally I don't think a redirect is warranted here. Dottore So 19:52, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:05, 13 November 2005 (UTC)

[edit] Mel Booth

Delete. A sport journalist of a newspaper. The newspaper doesn't even have its own article. Written by an anon user who was blocked an hour ago. *drew 02:54, 7 November 2005 (UTC)

  • According to this, the Huddersfield Daily Examiner has a circulation of 82000, meaning that this journalist writing for it satisfies the WP:BIO criterion for published writers. However, there is a significant lack of independent source material on this person. Uncle G 03:32, 7 November 2005 (UTC)
  • The newspaper now has its own article. Anthony Appleyard 06:35, 7 November 2005 (UTC)
  • Comment. A Google search for (Mel Booth Huddlesfield) does confim that he is a sparts journalist. Whether that makes him notable enough for his own article is a different issue. I'll reserve my vote for the moment. - Dalbury (talk) 18:38, 7 November 2005 (UTC)
  • Delete - a sports journalist on a minor English regional newspaper is non-notable, even if the newspaper itself may be. ➨ ❝REDVERS❞ 20:10, 7 November 2005 (UTC)
  • Delete per nom. Ifnord 22:18, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedied under G3 as a hoax. - ulayiti (talk) 18:10, 8 November 2005 (UTC)

[edit] Melissa Al-Sabah

This could be a bogus bio; though I was able to verify that the al-Sabah family is indeed the ruling family in Kuwait, none of the other names turn up on a Google search (which doesn't necessarily mean that it's bogus). Jasmol 17:06, 6 November 2005 (UTC)

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:22, 7 November 2005 (UTC)
  • Comments only, no vote: in case, any one has any information, kindly share. Thanks. --Bhadani 13:33, 7 November 2005 (UTC)
  • Delete blatant hoax. Possibly speedy as vandalism, though that's a bit controversial where hoaxes are concerned. Wikipedia itself demonstrates this: if you go to Kuwait, you'll find a nice big infobox with the names of the current ruler (Emir Jaber al-Ahmad al-Jaber al-Sabah, not "Sethi J.") and crown prince (His Highness Sheikh Saad al-Abdallah al-Salim Al Sabah). Needless to say, there is no mention of the latter having considered a change of name to Melissa, let alone a sex change. — Haeleth Talk 23:43, 7 November 2005 (UTC)
  • Delete as per Haeleth FRS 01:46, 8 November 2005 (UTC)
  • Delete as hoax. The position of Emir of Kuwait is limited to males. Whoever this person is meant to be, she's not the heir to the Kuwaiti throne. --Metropolitan90 05:55, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedily deleted as a re-creation of previously deleted material.--Scïmïłar parley 17:07, 7 November 2005 (UTC)

[edit] Middlesbrough Soccability Football Club

This page has already been deleted and has now re-appeared with no explanation. Delete again! Keresaspa 16:38, 7 November 2005 (UTC)

  • Comment Apologies for including the previous thing but I'm new at this deletion game. Anyway, at the risk of repeating myself delete Keresaspa 16:43, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.


The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or on a Votes for Undeletion nomination). No further edits should be made to this page.

The result of the debate was Delete — redirect seems unnecessary as search should go to the club. This club is real, but perhaps should have a section in the main article. --Gareth Hughes 17:28, 22 October 2005 (UTC)

[edit] Middlesbrough Soccability Football Club

Consisted of an infobox only, tagged for cleanup since July. I added context, but is this club notable? 60 Google hits for Middlesbrough Soccability (without quotation marks) suggests it isn't. Punkmorten 15:12, 15 October 2005 (UTC)

  • Suggest redirecting to Middlesbrough F.C. as they share the same badge and are presumably connected (never heard of them or soccability for that matter). If there is no connection then delete. Keresaspa 15:14, 17 October 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in an undeletion request). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Physchim62 (talk) 14:23, 13 November 2005 (UTC)

[edit] M.V.B.consulting.Bcn

Spanish article about non-notable IT company - see Babelfish translation Hitchhiker89 17:17, 7 November 2005 (UTC)

  • Delete I don't read spanish, but I can tell this is an advert --Rogerd 03:38, 10 November 2005 (UTC)
  • delete as per nom Pete.Hurd 22:36, 12 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was no consensus to delete. Mailer Diablo 11:49, 10 April 2006 (UTC)

[edit] National Association of W Lovers

First AfD archived at Wikipedia:Articles for deletion/National Association of W Lovers 1 CanadianCaesar Et tu, Brute? 04:46, 5 April 2006 (UTC)

Non-notable sketch from a TV show. Pugs Malone 03:56, 5 April 2006 (UTC)

  • Delete as extremely non-notable fictional club. (And I'm a member! I ♥ W!) dbtfztalk 04:23, 5 April 2006 (UTC)
  • Merge. It doesn't deserve its own article, but it is a relatively famous bit on Sesame Street. It probably should be merged with the Sesame Street or Sesame Street songs page. YellowPigNowNow 04:43, 5 April 2006 (UTC)
  • Redirect to Blogs For Bush Merge per above. Sandstein 05:12, 5 April 2006 (UTC)
  • Keep cultural phenomenon, possibly merge. For great justice. 07:15, 5 April 2006 (UTC)
  • W-W-W-Week Keep - That vote made by my inner child only because when I was four my favourite letter was "W" (I really liked Wanda The Witch on Sesame Street!). Fluit 07:39, 5 April 2006 (UTC)
  • Delete as non-notable. -- Kjkolb 14:10, 5 April 2006 (UTC)
  • Keep or possibly merge with other sesame street songs, but definately not delete ⇒ SWATJester Ready Aim Fire! 19:06, 5 April 2006 (UTC)
  • Merge per YellowPigNowNow. --Khoikhoi 22:59, 5 April 2006 (UTC)
  • keep or week merger/redirect to sesame street if sesame street isn't cluttered to much. --CyclePat 04:18, 6 April 2006 (UTC)
  • Delete or merge with Republican National Committee :) Fishhead64 05:23, 6 April 2006 (UTC)
  • delete if you must, but it did make me laugh. Not at all what I expected. --MrFizyx 23:25, 6 April 2006 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Delete. Hedley 03:34, 13 November 2005 (UTC)

[edit] Nation's Giant Hamburgers

Delete as per WP:NOT - advertising Bjelleklang - talk 23:12, 7 November 2005 (UTC)

  • Also nominating Nation's. --Alan Au 23:13, 7 November 2005 (UTC)
  • Delete Nation's, mark Nation's Giant Hamburgers copyvio of[22]. 24.17.48.241 23:40, 7 November 2005 (UTC)
  • Delete as cut-&-paste copyvio as per above. Eddie.willers 23:45, 7 November 2005 (UTC)
  • Added copyvio tag, blanked content. If it's a copyvio, let WP:CP handle it. Good burgers, though. --Calton | Talk 01:17, 8 November 2005 (UTC)
  • Delete NN burger joint (both instances) Just zis Guy, you know? [T]/[C] :: AfD? 10:52, 8 November 2005 (UTC)
  • Delete advert --Rogerd 02:36, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:20, 13 November 2005 (UTC)

[edit] Nef

This has been tagged for wiktionary for months. I haven't transwikied because 1) it looks like a neologism, and I'm not sure if wiktionary would want it, and 2) I don't bother with wiktionary. Basically, I don't care what happens to it, but I think it should be deleted from wikipedia. -R. fiend 05:31, 7 November 2005 (UTC)

  • delete per nom.—Gaff ταλκ 05:33, 7 November 2005 (UTC)
  • Delete neologisms. Never heard the word. — Haeleth Talk 19:04, 7 November 2005 (UTC)
  • Delete obvious neologism. There actually is a word "nef" in some English dictionaries, but it's usually a redirect to "nave" (the central part of a church). Ifnord 22:29, 7 November 2005 (UTC)
    • Maybe redirect to nave then? Unless it's a foreign word? -R. fiend 06:48, 11 November 2005 (UTC)
  • Delete neologism JFW | T@lk 01:26, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. — JIP | Talk 12:22, 13 November 2005 (UTC)

[edit] Nick Smith (Bassist)

The band page seems NN enough to me, but it mentions a band member of another band, and im not familiar enough with this type of music to know whether or not Firegarden is notable (though it does have its own page, so maybe...). In any case, this page (as well as this one) seem superflous to me. jfg284 10:36, 7 November 2005 (UTC)

  • Delete per nomjfg284 10:36, 7 November 2005 (UTC)
  • Keep any verifiable information that can be salvaged, otherwise redirect to the band. Trollderella 19:51, 7 November 2005 (UTC)
  • Delete fails WP:MUSIC --JAranda | watz sup 01:20, 10 November 2005 (UTC)
  • Delete per JAranda.-Dakota t e 02:00, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was to merge the article with Elgin, Illinois.  Denelson83  04:44, 12 November 2005 (UTC)

[edit] Notable Elginites

No reason to be its own article, should be part of Elgin, Illinois as most lists of notables are part of their towns. gren グレン 02:07, 7 November 2005 (UTC)

  • Keep, Putting it on the main page makes the primary article too lengthy. see chicago's entry, which has not only one but two different articles: "Famous Chicagoans" and "Notable citizens of Chicago" —Preceding unsigned comment added by 69.217.135.66 (talk • contribs) 22:12, 6 November 2005
    • I took the liberty of adding the Keep, part since the comment was probably meant to be a keep. I disagree because the town is not a big city like Chicago and therefore there is less reason for a separate page. gren グレン
  • Merge with Elgin, Illinois. Neither article is large enough to preclude a merger. --anetode¹ ² ³ 02:24, 7 November 2005 (UTC)
  • Merge with Elgin, Illinois.Capitalistroadster 02:41, 7 November 2005 (UTC)
  • Merge with Elgin, Illinois, per Anetode. Superm401 | Talk 04:21, 7 November 2005 (UTC)
  • Merge As above to avoid confusion with other Elgins. Marcus22 10:28, 7 November 2005 (UTC)
  • Merge per above. And possibly remove any which don't pass the WP:BIO test? - Just zis Guy, you know? [T]/[C] :: AfD? 19:01, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. — JIP | Talk 12:29, 13 November 2005 (UTC)

[edit] Novenonagintennecentupentamillimyrillion

A really, really large, really really non-notable (and likely artificially named) number. --Jeffrey O. Gustafson - Shazaam! - <*> 00:40, 7 November 2005 (UTC)

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:23, 7 November 2005 (UTC)
  • Delete - I believe precedent is against this. There is potential for an infinite number of these nn articles. If someone can prove this number has had any scientific use, then I'll change my vote. 23skidoo 13:05, 7 November 2005 (UTC)
  • Delete - Per nom. --Robby 15:42, 7 November 2005 (UTC)
  • I remember having read that there is a general consensus that number are not notable by themselves (the point is what 23skidoo said). However, this is not a number but the name of a number, which makes things slightly different: we have an article on Googol, for example. In this particular case, google returns 79 hits for the article name, which makes it non-notable. Therefore, Delete, but not because it is a number. Paolo Liberatore (Talk) 18:03, 7 November 2005 (UTC) (see below)
  • Smerge to Other names of large numbers. Trovatore 06:17, 8 November 2005 (UTC)
  • I would say Merge per Trovatore, but apparently the merge has already been done. Is Leave it alone a valid vote in AfD? Paolo Liberatore (Talk) 16:27, 8 November 2005 (UTC)
    • Someone has redirected it, which is the efficient solution but not entirely according to procedure. The AfD notice on the article is quite specific that the article should not be blanked, nor the notice removed, while the AfD is open. Without the notice, interested parties might miss out on the debate. These are general considerations; I don't plan to revert in this specific instance, but it would be the technically correct thing to do. --Trovatore 18:26, 8 November 2005 (UTC)
  • Delete with prejudice! This article is pointless. Unless someone wants and succeeds in writing a smashingly good article on this, I say delete. I've restored the AFD tag BTW. --C S 04:50, 11 November 2005 (UTC)
    • Merge/Redirect to Other names of large numbers. National Parks (talk) 22:01, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete all of them. - ulayiti (talk) 13:40, 13 November 2005 (UTC)

The remaining articles have been placed in Category:Candidates for speedy deletion. Deleting now... --AllyUnion (talk) 12:11, 16 November 2005 (UTC)
Done --AllyUnion (talk) 12:48, 16 November 2005 (UTC)

[edit] Articles contained in Category:Nursing care plans

On 20 Oct 2005 someone uploaded a flurry of supposedly public domain articles from the International Biopharmaceutical Association[23] website, all "nursing care plans" for a host of medical conditions (66 at last count). The pages are largely redundant with the medical conditions they are linked to, and very little original content can be found on them. THB (talk · contribs) tried to knock a few into shape and kindly placed them all in Category:Nursing care plans, but agreed that these pages are beyond hope. An RFC[24] on the situation reached the same conclusion, see Category talk:Nursing care plans.

I am therefore suggesting delete on all 66 articles. Care plans are not encyclopedia articles, and all useful content is redundant with other articles. JFW | T@lk 18:10, 7 November 2005 (UTC)

  • Delete I don't think nursing care plans belong to an encyclopedia. --WS 19:30, 7 November 2005 (UTC)
  • Delete I agree completely with JF's assessment. encephalon 22:53, 7 November 2005 (UTC)
  • Delete. Good information, but Wiki is not the place for them. Edwardian 23:07, 7 November 2005 (UTC)
  • Delete, not individually notable. BD2412 T 02:58, 10 November 2005 (UTC)
  • Delete per nom --Rogerd 03:37, 10 November 2005 (UTC)

We at IBPA don't think that your site has a future, with such approach. Deleting 66 articles with very valuable information - is a crime. Who among you understands in Nursing? How could you take responsibility to decide what is good, and what is no good?Do you own this site! It's a shame.

Thank you for your attention. (Unsigned comment from 206.188.102.2 after AFD closure. --AllyUnion (talk) 12:16, 16 November 2005 (UTC))

If you like to improve the general knowledge of Nursing, you may do so at the Nursing article in a neutral point of view fashion. If you like to contribute more information on the treatment or the natural of illnesses, you may do so at any of the cooresponding illness(es)' articles. --AllyUnion (talk) 12:20, 16 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP. Robert T | @ | C 03:19, 13 November 2005 (UTC)

[edit] Patra TV

Non-notable, are we going to create an article for every single TV station in the world? Delete. NSLE (讨论) \<extra> 08:40, 7 November 2005 (UTC)

We should create as much as possible. Therefore keep. Deryck C. 09:41, 7 November 2005 (UTC)
  • Keep as Patras is a city of 171,000 and this appears to be it's only TV station. I strongly disagree with keeping all television stations, however. Some have a tiny range and very few viewers (usually religious stations that don't care about making a profit and rebroadcast material made somewhere else). -- Kjkolb 13:48, 7 November 2005 (UTC)
  • Keep all television stations except for those with tiny range and very few viewers. Kappa 16:12, 7 November 2005 (UTC)
  • Keep per Kjkolb. This one is kind of borderline (how many people must a city have for a local TV station to be notable?), but I am for keeping. Paolo Liberatore (Talk) 18:57, 7 November 2005 (UTC)
  • keep please a article for all television stations in the seems like a good idea Yuckfoo 01:20, 8 November 2005 (UTC)
    • Comment an article for every TV station in the world is a very bad idea. Please. Paolo Liberatore (Talk) 11:50, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was the result of this debate was Keep. Nomination withdrawn.Gateman1997 00:53, 11 November 2005 (UTC)

[edit] Peter George Wellesley Graves, 8th Baron Graves

NN, D. ComCat 03:03, 7 November 2005 (UTC)

Nomination withdrawn. This article had no substance of note when originally nominated, [25] now it does. ComCat 05:07, 10 November 2005 (UTC)
  • Keep and Expand. Members of the Nobility are inherently notable.--Nicodemus75 04:30, 7 November 2005 (UTC)
  • Keep and expand given that he is a baron. BTW, Comcat could you please provide an explanation of your nomination. Capitalistroadster 05:36, 7 November 2005 (UTC)
  • Keep. Nobility, and I believe that means that he was in the House of Lords. Utterly pointless to write "NN D" without giving any reason why a baron should be not notable. Sjakkalle (Check!) 09:45, 7 November 2005 (UTC)
    • Apparently not in the British House of Lords since Graves is an Irish district. Still, I think barons are inherently notable. Sjakkalle (Check!) 14:45, 7 November 2005 (UTC)
      • I'm not sure that that makes any difference. Southern Irish people retained the right to vote in the UK, and something similar may well have applied to all Irish peers. British and Irish peerages were never territorial, and peers often had no real connection with the locality from which their title was derived. CalJW 01:22, 8 November 2005 (UTC)
  • Comment Am I right in assuming that "nobility are inherently notable" is a Wiki standard? If so, I'd like it called into debate. Here in France, for example, every tenth person is Comte de This or That. That would mean we need about 10,000,000 entries... I exaggerate of course, but are we really to include every son of every son of a Lord or Baron? As the answer is probably no, then where do we draw the line? Marcus22 10:42, 7 November 2005 (UTC)
    • Younger sons are not peers in the UK. There have only ever been a few hundred peers at a time. One is either a peer or not. The distinction is very clear cut and utterly different from the situation in France. CalJW 13:37, 7 November 2005 (UTC)
  • I have an issue with the idea that the holder of every noble title is inherently notable. The title may be worthy of an entry, e.g. Graves Baronetcy under which individuals can be listed, but this kind of entry simply justifies a compendium of minor notability for no other reason than the existence of the title itself. Where should the importance be placed? Delete Dottore So 11:56, 7 November 2005 (UTC)
    • In general, any article on someone who has held a seat in national parliament winds up being kept (see WP:BIO, even though I realize that this person is dead now). Being a baron in Britain places you in the House of Lords, the upper house of the British parliament. Sjakkalle (Check!) 12:13, 7 November 2005 (UTC)
    • Also a Baron is not exactly a Baronet.--Nicodemus75 12:20, 7 November 2005 (UTC)
      • yes I meant barony, not baronetcy. Also, let me stress in the strongest possible terms that I don't see this in inclusionist/exclusionist terms, since I wholeheartedly agree that the holder of the title has an inherent notability; however, I believe it a sustainable assertion that that same notability accrues as a condition of the title which makes the more encyclopedic subject the title, not the individuals, except, obviously, in those cases where the individual has obtained some degree of notability outside that granted by the title in the first place. Such, for example, would be the case of [his successor] who performed the singular feat of getting married ten years before he was born according to his WP entry. Now that is notable! Unless the article can point to something that, sui generis, indicates this fellow deserves a separate article, imo it might be better practice to accumulate such lists of names under the title. After all, sitting in the house of lords was an inherited right, by virtue of ennoblement (although I believe that Irish peers lost this by the 20th century). That as I see it could in itself suggest that the encycopedic importance resides with the title.
        • Whilst I will not vote Delete on this, I feel Dottore So has the right approach: often it is only the title which is noteworthy and not necessarily the holder. In this particular case, the 8th Baron could just be listed on the Graves title page unless he has other claims to fame to warrant a page of his own. Also, re the house of Lords: being a peer no longer entitles one to a seat there. It is now a house of appointed representatives the vast majority of whom are only life-Peers. Though this would not have been the case with this particular Baron, it perhaps needs bearing in mind in future. Marcus22 15:46, 7 November 2005 (UTC)
  • Keep All members of the House of Lords. CalJW 13:37, 7 November 2005 (UTC)
  • N, K. Hipocrite - «Talk» 15:01, 7 November 2005 (UTC)
  • Keep. No valid reason for nomination given, this person is verifiable. Trollderella 19:39, 7 November 2005 (UTC)
  • Delete, verifiable, but completely non-notable noble. I wholly reject the assertion that he is notable because he was a baron. What did he do that was notable? Be born? Inherit a lovely estate? Die? If he had been in the House of Lords this would be a hands down Keep, but as it stands, the 8th Baron Graves is just as non-notable as the next chap; he just had the luxury of a barony to ease his way though life.--Isotope23 20:16, 7 November 2005 (UTC)
    • CommentWithdrawing my Delete per CalJW's citation... at least Sir Graves did something with his life.--Isotope23 03:53, 8 November 2005 (UTC)

*Delete. Unless he is notable in is own right, and not by virtue of simply being a Baron, he should rate no more than a listing in an article about the Barony. - Dalbury (talk) 00:04, 8 November 2005 (UTC) - vote withdrawn - Dalbury (talk) 02:07, 8 November 2005 (UTC)

  • Major new information Apparently the family had fallen on hard times, as he worked as an actor, appearing in 32 films, including at least 2 where he was first billed. imdb profile CalJW 01:30, 8 November 2005 (UTC)
  • keep - I agree about the notability of British peers. Baronets too, FWIW. -- Geo Swan 01:56, 8 November 2005 (UTC)
  • Keep in light of the new info about his movie career I'm changing my vote to keep. However I stand by the assertion that nobles are not inherently notable as we're not living the the pre-19th century anymore. "Nobility" is a quaint vestige of the old world... nothing more and current "nobility" are no more inherently notable then the average person. Gateman1997 02:03, 8 November 2005 (UTC)
  • Keep A little googling shows that a "Vanessa Lee", nee Winifred Ruby Moule, born 1920, who appeared in at least one London stage production [26], was married to Baron Peter Graves. I accept that an acting career increases the Baron's notability. - Dalbury (talk) 02:07, 8 November 2005 (UTC)
  • Keep barons with additionally notable wives! :) Jacqui ★ 06:08, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:45, 13 November 2005 (UTC)

[edit] Picture framing

Already transwikie-ed. Delete per WP:NOT. brenneman(t)(c) 01:19, 7 November 2005 (UTC)

  • Delete per CSD:A5. Ingoolemo talk 08:17, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was REDIRECTED to Eyepatch. — JIP | Talk 12:34, 13 November 2005 (UTC)

[edit] Pirate eye patch

This seems to be a vanity/joke entry for a non-notable term. The first version of the article said first concieved in Paris France in 2005 by two unnamed brits. Thue | talk 22:10, 7 November 2005 (UTC)

  • Delete nonsense / neologism / no significant currency / typically pointless and uninteresting student prank. Just zis Guy, you know? [T]/[C] :: AfD? 11:50, 8 November 2005 (UTC)
  • Please dont delete The article has now been updated to show that this term is broadly used on the south coast and west of england and is not nonsense. If the wikipedia has such articles as the donkey punch then i dont see why pirate eye patch cannot be included as well.
    • Unsigned comment by User:E mpika
  • Delete. Vanity neologism. If this term were broadly used, it would show up at least once on a Google search. A search for "pirate eye patch" yields several pages of Halloween accessories, but nothing in any way related to sex. Compare this to the massive results for "donkey punch". Bhumiya/Talk 18:37, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:01, 10 November 2005 (UTC)
  • I just redirected it to pirate. much less fuss than deletion. Though if you still want to delete it, count this as a delete. - Nunh-huh 03:07, 10 November 2005 (UTC)
    • Since there is no mention of eye patches at pirate I think the redirect does not serve any purpose and should be deleted. Thue | talk 17:48, 10 November 2005 (UTC)
      • Actiually, on second look there is a mention, a link to Eyepatch. That is a better redirect. Thue | talk 18:29, 10 November 2005 (UTC)
    • I agree. There's no reason for this page to exist. Bhumiya/Talk 17:54, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete as neologism/spam. - ulayiti (talk) 13:38, 13 November 2005 (UTC)

[edit] Porncasting

Neologism/advertisment for WatchMePaint.com listed above.-- GraemeL (talk) 21:10, 7 November 2005 (UTC)

  • I believe that if a person/company/organization plays a critical role in establishing a new term, then that person/compnay or organization should be credited as a pioneer. It would be wrong for any porn maker to list himself under pornography but in this case - since this is a very new idea - WatchMePaint.com should be credited with being one of the pioneers. This is just my opinion. (preceding unsigned comment by 206.69.163.39 (talk • contribs) )
  • Delete yet another non-notable neologism Just zis Guy, you know? [T]/[C] :: AfD? 22:13, 7 November 2005 (UTC)
  • I have cleaned up the article a bit, removing the advertising and adding some links where it has been used (most notably on the Guardian blog). However, I still think this belongs in iPod, because this would not have come about without the addition of a screen to the latest iPod. So merge to iPod. Jacqui ★ 06:45, 8 November 2005 (UTC)
  • I would support Jacqui's suggestion but only to the extent of noting that adding "casting" to the end of everything has become a popular form of neologism, with this as a siongle-word example. It's not as if the conept is anythign other than blindingly obvious from the name, after all. - Just zis Guy, you know? [T]/[C] :: AfD? 09:39, 8 November 2005 (UTC)
  • Delete advert --Rogerd 03:08, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. — JIP | Talk 12:36, 13 November 2005 (UTC)

[edit] Precotting

Non-notable neologism dicdef. Thue | talk 22:16, 7 November 2005 (UTC)

  • Speedy delete ➨ ❝REDVERS❞ 22:17, 7 November 2005 (UTC)
  • Delete neologism, dicdef, no significant currency. Just zis Guy, you know? [T]/[C] :: AfD? 11:49, 8 November 2005 (UTC)
  • Keep Should be moved to wiktionary. Not deleted. Big Booger 15:16, 8 November 2005 (UTC)]
    • That's a "transwiki" vote, then, not a "keep" vote, because once something has been moved to Wiktionary it is then deleted from Wikipedia. Oh, and Wiktionary does have basic requirements for inclusion, you know. Have you checked that this word would meet their standards? — Haeleth Talk 16:59, 8 November 2005 (UTC)
      • Comment Don't worry too much about it, Haeleth - I think the vote is just Big Booger wikistalking me on AfD a little bit. I think he/she/it has got bored of it already :) ➨ ❝REDVERS❞ 21:53, 8 November 2005 (UTC)
  • Delete neologisms. Heck, the word's even spelt differently in the title and the article! — Haeleth Talk 16:59, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:02, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedy: nonsense. -R. fiend 05:51, 7 November 2005 (UTC)

[edit] Professor Farnsworth's Famous Quote

This page is not suitable for Wikipedia because it's content is insignificant and subjective. The media it linked to has already been removed. Caillan 05:14, 7 November 2005 (UTC)

  • Call it nonsense. I'm speedying this. -R. fiend 05:51, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:57, 13 November 2005 (UTC)

[edit] Ranchecanch

Neologism that gets no google hits. NatusRoma 02:32, 7 November 2005 (UTC)

  • Delete protologism --anetode¹ ² ³ 02:50, 7 November 2005 (UTC)
  • Delete for no reason -- after all, it's not a word... Ok, per nom. Paolo Liberatore (Talk) 19:47, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:15, 13 November 2005 (UTC)

[edit] Redating sphinx

All the information in this article is already present in both Great Sphinx of Giza and Robert M. Schoch, so it doesn't serve any useful purpose anymore (f it ever did). Now it's just in violation of Wikipedia policy regarding splitting out controversial sections of articles. --Quuxplusone 21:17, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:14, 13 November 2005 (UTC)

[edit] Remixism

Nonsense. Another user claims this is not nonsense, so I am listing here instead of speedying... Thue | talk 22:26, 7 November 2005 (UTC)

  • Delete. Could be speedy deleted as G4 - previously deleted --keepsleeping say what 22:33, 7 November 2005 (UTC)
  • Delete nonsense / hoax / not notable even if it wasn't. Just zis Guy, you know? [T]/[C] :: AfD? 11:48, 8 November 2005 (UTC)
  • Delete. (I added the original speed-delete tag). The original text is here. Can we redirect this to Remix and protect the page to prevent this being added again? - N (talk) 19:03, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:00, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete as non-notable. - ulayiti (talk) 13:37, 13 November 2005 (UTC)

[edit] Rob Alexander

The band page seems NN enough to me, but it mentions a band member of another band, and im not familiar enough with this type of music to know whether or not Firegarden is notable (though it does have its own page, so maybe...). In any case, this page (as well as this one) seem superflous to me. jfg284 10:36, 7 November 2005 (UTC)

  • Delete per nomjfg284 10:37, 7 November 2005 (UTC)
  • Keep any verifiable information that can be salvaged, otherwise redirect to the band. Trollderella 19:51, 7 November 2005 (UTC)
  • Delete fails WP:MUSIC --JAranda | watz sup 01:19, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. - ulayiti (talk) 13:36, 13 November 2005 (UTC)

[edit] Rocafella Gangsta Crip

Unverified. Unverifable? Potentially encyclopedic and mergable into Crip gang article if that exists, but as it stands does not look at all useful.—Gaff ταλκ 05:35, 7 November 2005 (UTC)

Delete Per nom, its not written as an encyclopedia article doesn't appear notable either. KnowledgeOfSelf | talk. 07:09, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:03, 13 November 2005 (UTC)

[edit] Ronnie Choi

Appears to be vanity

  • Delete per nomination. - Rholton 02:53, 7 November 2005 (UTC)
  • Delete. Vanity bio. "well-known for being the best friend of IT twins" - this statement says enough of Choi's notability. *drew 02:58, 7 November 2005 (UTC)
  • Delete, per *drew and nominators. Superm401 | Talk 04:15, 7 November 2005 (UTC)
  • Delete. Never 'eard of 'im. Yet a-$£%&-nother non-notable minor pop music singer. Anthony Appleyard 06:20, 7 November 2005 (UTC)
  • Delete. No Allmusic page for him or his band, and no literary references to any of his cookbooks either. The comic book doesn't exist yet, and there isn't enough buzz around it to make the process of its development notable. -Colin Kimbrell 17:16, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP. Robert T | @ | C 03:13, 13 November 2005 (UTC)

[edit] Ross Clarke-Jones

Nn, vanity? Havent heard of him for sure. Delete, or speedy if it fits criteria (See below)NSLE (讨论) \<extra> 08:27, 7 November 2005 (UTC)

  • Keep, expand and clean up. Notable Australian big wave surfer. First non-Hawaiian to win the Quicksilver challenge see [27]. There seems to be other verifiable material about him with over 9,000 Google hits see [28] including an interview with surfing magazines such as this see [29]. Appears to meet WP:BIO. Capitalistroadster 08:54, 7 November 2005 (UTC)
  • Note: This debate has been included in the list of Australia-related deletions. . Capitalistroadster 09:04, 7 November 2005 (UTC)
  • Strong keep, professional big-wave surfer sposored by Quicksilver. Notable -- Ian ≡ talk 09:26, 7 November 2005 (UTC)
  • Strong keep. Internationally notable surfer; vote to shoot nominator for not even doing the most cursory Google check before nominating for deletion. Ambi 09:35, 7 November 2005 (UTC)
    *dies* Sorry 'bout that. I should have checked Google yes, and I apologise for being extremely busy with exams and having to rush off in the middle of this afd ;). Keep (clean up and expand), btw. NSLE (讨论) \<extra> 10:02, 7 November 2005 (UTC)
  • Keep. Quick Google reveals that he is a well-known surfer. --Cnwb 22:13, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Keep with move to Rustication (academia). (Original title redirected to Rustication, a disambig page). Physchim62 (talk) 14:32, 13 November 2005 (UTC)

[edit] Rusticated

dicdef Flapdragon 00:03, 7 November 2005 (UTC)

Would be useful in a glossary of Oxbridge terminology (OK, not necessarily Oxbridge, but typically so), which I think has been proposed on some talk page but does not yet exist AFAIK. Would not normally expect to find it in the past participle though, as opposed to the infinitive (to rusticate) or the noun (rustication). Flapdragon 00:07, 7 November 2005 (UTC)

  • Delete. The article does not assert any significance to the said term. --Hurricane111 00:17, 7 November 2005 (UTC)
  • Keep. Well known term, used most often in the past participle, though the article should be expanded, and the term more clearly defined. Pintele Yid 00:19, 7 November 2005 (UTC)
    • Please note our Wikipedia:naming conventions (verbs), our Wikipedia is not a dictionary official policy, and the existence of rusticate and related words in the dictionary. Please explain what encyclopaedia article you envision here (as opposed to at rustication). Uncle G 00:28, 7 November 2005 (UTC)
      • It could be expanded to include names of famous people who have been rusticated, and the types of offenses it is used for. It could also discuss how the universities are allowed in law to restrict the movements of their students. It used to be (don't know whether it still is) that the universities could ban students from traveling to within four miles of the town centers, which would otherwise be regarded as a violation of civil liberties. And finally, it could discuss how being "sent to the country," which is what rusticated means, was regarded as about the worst thing you could do to someone socially. It could be an interesting article with some work. Pintele Yid 00:38, 7 November 2005 (UTC)
        • Any source for this new meaning? Ostracising someone socially, sending them to Coventry [which amusingly is only two letters away "country"!]? Can't confirm in any dict including OED. Flapdragon 14:35, 7 November 2005 (UTC)
        • That would be an article at rustication, not this article. I repeat: Please note our Wikipedia:naming conventions (verbs). Uncle G 00:49, 7 November 2005 (UTC)
  • Delete* Someone has to keep this site manageable!Ryoung122 00:33, 7 November 2005 (UTC)
  • Keep I have found some wikipedia articles where the word "rusticated" is used [30], so it is nice to keep the article to explain the term. According to a comment in [31], Isaac Newton was rusticated, when he sat under the Apple Tree. Seems that the word rusticated applies to banishment due to other reasons as well, not just for punishment. --Vsion 01:48, 7 November 2005 (UTC)
  • Redirect and merge per Silence. --Vsion 01:24, 8 November 2005 (UTC)
  • Redirect and merge into rustication suspension. Wikipedia does not make exceptions for verb form just because the past participle is used more often than the noun. Countless pages use verb and noun forms other than the ones most commonly used for the sake of consistency, because, unlike disputes over which name is correct for a person or place or whatnot, it is easy to be consistent regarding verb form, which makes things much simpler for anyone trying to find these articles. Plus both rustication and rusticated are so small that merging them does no harm, and helps make both less like dictionary-ish. If we had an "expulsion" article that wasn't just a disambiguation page, I'd recommend merging it into that. -Silence 03:23, 7 November 2005 (UTC)
  • Comment. It seems that Rustication (architecture) and Rusticated (academia) have quite distinct meanings. Should they be in the same article? --Vsion 03:33, 7 November 2005 (UTC)
  • Merge into rustication, per Silence. This seems worth discussing encyclopedically. Superm401 | Talk 04:19, 7 November 2005 (UTC)
  • Keep as per Pintele Yid--there's more to be said about the historical practice, the effect it may have had on particular figures, and the guidelines for it today. I'd oppose merging it with rustication; even under the guidelines cited above, it should be moved to "rusticating," not "rustication," no? --Dvyost 07:46, 7 November 2005 (UTC)
    • Move and keep. Silence has persuaded me--move this sucker to Rustication (academia). I can't speak for British Universities, but I know Harvard has used the practice--they used to dump unruly students at Brook Farm during its years of operation. --Dvyost 15:17, 7 November 2005 (UTC)
  • Keep. Could become an interesting article. Absolutely don't merge. By the way it is NOT exclusively an Oxbridge term -> [32]--Alicejenny 07:54, 7 November 2005 (UTC)
    • For the record, no-one has asserted it was just an Oxbridge term (the aricle referred to Oxford), though I would be surprised if it was in use in most British universities.
  • Keep as a well-known term with notable examples in literature and British public life (e.g. Oscar Wilde and Auberon Waugh); the usage is distinct from rustication, the term rusticated is used in this context, rustication generally not. Needs expansion, but is more than a dicdef and more than a variant of the (unrelated) rustication. Links between the two would help to avoid ambiguity. - Just zis Guy, you know? [T]/[C] :: AfD? 13:29, 7 November 2005 (UTC)
    • Wikipedia isn't about defining words (like a dictionary), it's about describing concepts. As has been pointed out, it's not a question of what form the verb is most commonly found in: even if it's more common to speak of being electrocuted, the concept will be dealt with at electrocution.
  • Correct. If it were to be kept in its own article, the only acceptable form would be Rustication (academia) or similar. The commonly used form of a verb is not an excuse for breaking the standard format for articles named after verbs, which is to use the noun form—which is "rustication", not "rusticating", obviously; "rusticating" would be if it were in a sentence in the article, like an article about "Colleges rusticating students". "Rusticated" would be appropriate for an article about "Students who have been rusticated". "Rustication", however, is the standard for the concept itself. Also note that "rustication" is nothing but a British variant on the meaning of rustication; it is not a different word, just one of several definitions of the same word, with the definition at "rustication" being another of these definitions. -Silence 15:07, 7 November 2005 (UTC)
  • Rephrasing vote, see below. Weak keep. Move, merge, wherever; but I do feel strongly that enough dabs and redirects should be created to ensure that anyone, curious about the academic usage, who types in "rusticate" or "rusticated" as the "go" term, will easily find what they seek. I found a boatload—well, several more—literary references, and some British and U.S. notables who were rusticated in their college days. It seems that the term was not limited to England but was also common in nineteenth-century America. I have a preference for keeping it at rusticated, because, in reference to college suspension, the word is frequently used in that form, whereas "rusticate" and "rustication" seems to be rare. Despite what folks say are naming conventions (I thought "use the most common term" was the überconvention. But whatever. Dpbsmith (talk) 15:56, 7 November 2005 (UTC)
  • That convention applies to choosing between different words, names, and titles, not between different forms of the same word. In other words, the "name article after the most common name" would apply if we were discussing which of two more-or-less-synonymous words to have an article at, with the less-common name being a redirect to the more common one. The rule does not apply to choosing between different forms of a single noun, verb, adjective, etc., however: with that, the policy is quite clear, to have all nouns singular (even though very often the plural is more common) and all verbs in their noun form, rather than in a past participle form like "rusticated". For non-Latin words, "-ing" is typically the noun ending (running, eating, bleeding, juggling, etc.) whereas Latin words tend to have an "-ion" ending, especially "-ation" (cancellation, excommunication, navigation, masturbation, etc.), and still other words can have the same form as a noun or verb, avoiding the problem altogether (love, cough, sleep, hope, etc.). But regardless, only in truly rare and unusual situations is a form like "rusticated" ever used; simply having one form be more common is not good enough. There are many other words that are almost always used in -ed form and yet aren't listed there; being consistent is a good thing, and means we don't have to make tricky judgment calls like "'Vikings' is more common than 'Viking'" or "'obey' is more common than 'obedience'", which are sadly unavoidable with most names, titles, etc. -Silence 22:46, 7 November 2005 (UTC)

Move to Rustication (academia) per Dvyost's suggestion. - Dalbury (talk) 17:49, 7 November 2005 (UTC) Withdrawing this vote. - Dalbury (talk) 21:38, 7 November 2005 (UTC)

  • Keep. Trollderella 19:29, 7 November 2005 (UTC)
  • Comment In discussing merges, moves, and general organization, I think we should consider... is rustication not a synonym for "suspension?" Suspension, at least in the U. S., is the name for an academic disciplinary action, stronger than probation but weaker than expulsion, defined as loss of student status for a specified (limited) period of time. e.g. Stanford defines it that way and then goes on: "All rights and privileges of student status are suspended during this time, including but not limited to: the right to attend classes; use library facilities; use any other facilities of the University except those open to the general public; obtain credit for any academic work; engage in any activities, or hold any position on any University committee or student organization, whether appointive or elective; live in student housing; participate in intercollegiate athletics." Loss of the right to "use any other facilities except those open to the general public" sounds essentially the same as "the student may not enter any of the university's buildings or facilities." Dpbsmith (talk) 20:21, 7 November 2005 (UTC)
  • Good point. And, for obvious reasons, suspension gets over 400 times as many hits on Google. Suspension is currently a disambiguation page; if listing noteworthy people who have been rusticated is a worthwhile endeavor, then why not also list noteworthy people who have been suspended? Why not make a page for suspension in an academic context, merge this information to that page, and then simply list at the top of Rustication, "This article is about the architectural term. For the academic term, see Suspension (academia)". Then we could mention both terms, and the differences between them, on that page. Wouldn't that solve all of these problems?
  • Anyway, regardless of what we do, the current situation is clearly ridiculous: (1) having a disambiguation page for only two pages is absurdly inconvenient and unnecessary, rather than just picking one and having it link to the other; (2) if Rustication is going to redirect to Rustication (disambiguation), why not just make Rustication itself the disambiguation page?! No matter what, Rustication (disambiguation) is a bad idea; (3) my original suggestion of merging the two Rustications onto one page was actually, if you like, supposed to be a quasi-disambiguation page, sans the links and with a bit more information on each item, to provide all the information necessary on both terms in a quick and simple manner. I recommended it because there was so little information on each term, with the idea that they might eventually be turned back into separate articles once they'd been expanded enough. But such a solution isn't ideal, so I'm happy now that an ideal one has been found: create an article for suspension and put this there as a type of suspension, and leave the architectural term at rustication with a link to suspension/rusticated. -Silence 22:46, 7 November 2005 (UTC)

**Delete. In Wiktionary, the first meaning of rusticate is "(British) to suspend or expel from a college or university". That seems pretty straight forward to me. - Dalbury (talk) 21:38, 7 November 2005 (UTC) - changing my vote to Merge and Redirect per User:Silence as the best outcome that has a chance here. - Dalbury (talk) 17:50, 8 November 2005 (UTC)

      • That's the dicdef alright. Now look at the article itself. It contans references to notable people who have been rusticated, including Wilde and Dryden, references to American usage in literature (Twain), historical usage at Harvard and so on. Much more than a dicdef. I vote delete on dicdefs as a matter of course, but I don;t think this article is one. - Just zis Guy, you know? [T]/[C] :: AfD? 22:02, 7 November 2005 (UTC)
        • Comment. Would you support an article called Expelled that listed famous people who had been expelled from school? The whole idea just does not strike me as encyclopedic. - Dalbury (talk) 22:36, 7 November 2005 (UTC)
          • Why not? There is an article for Graduation. --Vsion 22:44, 7 November 2005 (UTC)
            • Comment Graduation is often an important Rite of Passage. I don't see expulsion or suspension having anywhere near the same significance for most people. - Dalbury (talk) 23:32, 7 November 2005 (UTC)
Nonsense. Expulsion and suspension can be very significant events in many people's lives, often turning points in their goals and ambitions. Once we have an article for expulsion or suspension, we may want to consider incorporating pushout into it as well, since it's a much less common term than dropout. -Silence 23:41, 7 November 2005 (UTC)
I would strongly oppose such an article, because it violates Wikipedia naming conventions, just as Rusticated does. Expulsion would be the correct name. And yes, I'd support some sort of move like that, though it seems that Suspension is a much better description of the term and thus is a better candidate for making a new article to merge this into (as both "expulsion" and "suspension" are disambig pages, we'd either need to move them to (disambiguation), or, probably the better idea, add an (academia) or (education) or similar to the end of the name). Dictionary.com gives this meaning of the word as "Chiefly British. To suspend (a student) from a university."[33] -Silence 23:16, 7 November 2005 (UTC)
Comment. The article Rusticated as it stands now is defective, in my opinion, no matter what you call it. It currently is no more than a list of citations for the use of the word, and therefore belongs in a dictionary, not an encyclopedia. - Dalbury (talk) 23:32, 7 November 2005 (UTC)
I agree that the article as it stands now is defective. I don't know how I could have made that any clearer in my comments. I said to integrate it into a new article, called "expulsion" or "suspension" or similar, if only as a mentioning of the term. It obviously doesn't stand well on its own. -Silence 23:41, 7 November 2005 (UTC)
Comment. And as I said, the article is primarily a list of citations of useage, and I think that kind of thing belongs in a dictionary, not in an encyclopedia. I would be opposed to simply tacking it onto some other article. If someone can show how this material could be effectively integrated into an encyclopedic article, I would have no problem. - Dalbury (talk) 01:12, 8 November 2005 (UTC)
  • Keep its far more than a dic. def. I would suggest a cleanup though. Falphin 02:47, 8 November 2005 (UTC)
  • If it's far more than a dictionary definition, then why not merge it into suspension or suspension (academia), where it would be vastly more useful and accessible to readers? Or at the very least move it to rustication (academia), which happens to not violate Wikipedia naming conventions? Always a plus. But, again, a "suspension" page would allow us to avoid the entire problem and resolve this dispute immediately. -Silence 13:40, 8 November 2005 (UTC)
  • Keep, move I suppose to rustication, not that one often comes across the noun form. To be rusticated is quite different from being suspended, and as has already been pointed, the term has a long and crucial history in English culture. Chick Bowen 18:41, 8 November 2005 (UTC)
  • Yes, the noun form is to be used even when it's uncommon; we have redirects for that. But for the second time, if this is moved to rustication, what do you propose we do about the architectural term? Do you want them listed on the same page? -Silence 19:30, 8 November 2005 (UTC)
Disambig as usual, of course. In fact, I see it's already been done; Rustication is a disambig page pointing to Rustication (academia), which is currently a redirect but could be easily swapped with the page under discussion. I'm sorry, Silence, 'cause you seem kinda worked up about it, but I really don't see a problem. Chick Bowen 22:02, 8 November 2005 (UTC)
  • I'm not worked up about it, just interested; a scholarly, long-winded tone is hard to convey over the Internet, so it may come across as just being frenzied, which is not my intent. :) Anyway, I illustrated the problem with a disambiguation page above: it's impractical and pointless to have a distinct page for links to the two articles when you could just have the page go directly to one of the articles instead, and provide a link to the other at the top. In this way, the people looking for the other article are no more inconvenienced than they would be by a disambig, and the people looking for this article are much better off! Neutral/win situation. Also, even if we have a disambig page, having it at Rustication (disambiguation) makes no sense, because Rustication is just a redirect to that page--so why not have the disambiguation page at Rustication? So either way, Rustication (disambiguation) will have to go (and it looks like you agree on that at least, I think, and just didn't notice that Rustication is a redirect to a disambig page, not the disambig itself; correct me if I'm wrong), but for the most convenience and to stick with the standard for most Wikipedia articles, we probably shouldn't really have a disambiguation page at all, as they're usually only for when there are more than two or three articles to choose from, or in especially contentious situations where it's totally impossible to pick one over the other to start from. I don't think we're that stuck in the mud here. But anyway, thanks for clarifying! I only asked because I genuinely wasn't sure what your vote was; while you say "Disambig as usual, of course", you're only the second or third of all the people who have voted or commented here to yet say that we need a disambiguation page at all! (The other one I can think of is Uncle G, who's the person who changed the pages recently by moving the former Rustication page to Rustication (architecture) and having Rustication redirect to Rustication (disambiguation), both of which I think are mistakes—the only page that needs to be moved is "Rusticated", everything else worked more or less fine the way it was before this debate.) So it's not as clear-cut as you think. -Silence 23:51, 8 November 2005 (UTC)
        • Ah, I see what you mean. Yes, it's not as clear-cut as I was suggesting. Your suggestion is quite sensible, and I'm sure you can get an admin to do whatever you need to be done. My advice (I've done this): put it on requested moves, wait a couple days to see if you get any votes (you probably won't, I suspect) and then just ask an admin to do it--since nothing with any significant history would be deleted, I'm sure it'll be easy to make happen. Chick Bowen 02:50, 9 November 2005 (UTC)
  • Yeah, I'll pull some strings and see what I can get done. Doesn't hurt to at least see what it would look like to have Rustication be the architecture page + Wiktionary in external links and the link to "Rusticated" at the top. -Silence 03:29, 9 November 2005 (UTC)
  • I vote: Keep, and ask User:Silence to do whatever he thinks best after AfD is closed. In more detail: Keep most of the text in the present article, subject to cleanup and normal editing, and ask Silence do whatever moves, redirects, dabs etc. will, in his judgement, serve readers best. After all, whatever he does is just normal editing and anyone can change anything he does anyway. From the Talk page I see don't see anything remotely approaching a consensus to delete--I see at least a 2/3 vote to keep it in some form, in fact--and I don't see any strongly held views or overwhelming majorities on how, exactly to do this. Personally, the only situation I would object to is one where we have information about a topic, but a reader who types something reasonable into the Go box doesn't find it. Really, AfD is for discussing whether a page should be deleted. As long as we're here, if we're keeping it's not unreasonable to discuss how to keep it, but there's no reason to put that burden on the closing sysop. Dpbsmith (talk) 20:41, 8 November 2005 (UTC)
  • Heh! Well, I can't really show what my version of the articles looks like because I'm not an Admin; I could change all the article texts, but the history and talk for the page that used to be "Rustication" is currently at "Rustication (architecture)", and I'd need to be able to delete the "Rustication" redirect and move "Rustication (architecture)" there to make the pages functional. If I did it someone else would just have to redo it, in other words. But if anyone doesn't understand an aspect of the page moves I've proposed, I'd be glad to explain, demonstrate, or show examples of similar articles being handled in a similar way.
  • Also, I kind of wish you hadn't deleted your previous comment, because it's quite a reasonable suggestion, and is the suggestion I'd be endorsing myself if I thought that the topic "rustication in an academic sense" and the current article text we have merited a distinct article at this point, rather than a significant subsection of a larger article on expulsion and/or suspension in general. And, of course, having each article link to the other on the top, rather than wasting readers' time with an extraneous disambiguation page for only two articles, is just common sense. Why make twice as many people click an extra link when you don't have to? -Silence 23:51, 8 November 2005 (UTC)
I deleted it because I saw I was just repeating what you had already suggested. Dpbsmith (talk) 00:11, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. — JIP | Talk 12:39, 13 November 2005 (UTC)

[edit] Sal Barone II

this article COULD be improved but considering that it is an article on a almost unknown child actor, I think it should get deleted. --Phil 08:21, 7 November 2005 (UTC)

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:24, 7 November 2005 (UTC)
  • Speedy delete as recreation of previously deleted content. This article was up for deletion in January (see Wikipedia:Articles for deletion/Sal Barone). It doesn't look like the discussion was ever closed out, but Sal Barone was deleted. —BrianSmithson 18:47, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 05:01, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:11, 13 November 2005 (UTC)

[edit] Sarah Bovey

bio of a member of a non notable...google returns zero hits, currently looking for record deal jfg284 22:32, 7 November 2005 (UTC)

Delete per nomjfg284 22:32, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:47, 13 November 2005 (UTC)

[edit] Satanic Wizard

NN band vanity keepsleeping say what 01:38, 7 November 2005 (UTC)

  • Delete per nom. Zero Google hits for "Satanic Wizard" "Wizard Awakens"; zero relevant Google hits for any band member names. "Debut CD going gold" obvious hoax. --keepsleeping say what 01:40, 7 November 2005 (UTC)
  • Comment: Google does show a German heavy metal band by the same name.
  • Delete as per nom. Deltabeignet 03:00, 7 November 2005 (UTC)
  • Delete nn band. If their CD had gone gold, Google would have a reference to it. Bearcat 19:49, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Keep. Physchim62 (talk) 14:38, 13 November 2005 (UTC)

[edit] Scalar Gravity

Misleading, inaccurate, and apparently violates WP:NOR (see talk page) CH (talk) 00:38, 7 November 2005 (UTC)

  • Delete per nom. There are google hits for "scalar gravity", but they aren't talking above this model. For example, this journal abstract [34] explicitly refers to scalar gravity as unphysical. -- SCZenz 02:22, 7 November 2005 (UTC)
  • Weak Delete. The topic is potentially encyclopedic, and I have little objection to seeing alternative theories of gravitation covered in Wikipedia, but as-is this article has serious issues as per nom. It needs a history of the scalar models (more than is in the intro), it needs documentation in the article as to just whose theory is being documented and when and where it was published, and it needs documentation as to the serious problems in has (such as certain inconsistencies with observation). So I am open to seeing this article kept if significant changes are made. Otherwise my vote will not stay weak. --EMS | Talk 06:49, 7 November 2005 (UTC)
    • On futher consideration, I must conclude that this is an amateurish article created by an editor inexperienced in both general relativity theory and Wikipedia. Either that or that it is a hoax. [The article now includes the odd statement that is does not obey the equivalence principle, when in reality any metric theory of gravitation automatically will obey the weak equivalence principle; and then there is the metric signature of (-1, -1, -1, +1) instead of (+1, -1, -1, -1).] I may take a stab at rewriting it, but without a total rewrite, this article needs to go. (I will acknowledge that the anon whose article this is has been changing it, but he has utterly failed to address my areas of concern.) --EMS | Talk 15:54, 10 November 2005 (UTC)
    • Keep and Rename to scalar theories of gravitation (the name suggested by CH below), assuming that my rewrite sticks. --EMS | Talk 04:49, 12 November 2005 (UTC)
  • Delete as per nom. Karol 08:22, 7 November 2005 (UTC)
  • keep. I find the evidence for OR unconvincing. Other issues are a cause for rewrite AND NOT delete. --MarSch 10:43, 7 November 2005 (UTC)
  • Delete as original research. Even if not original research, a theory that predicts the opposite of what actually happens is unlikely to be notable unless it was widely believed for a substantial period of time or was believed or proposed by one of the leading researchers in the field. -- Kjkolb 11:15, 7 November 2005 (UTC)
    • Weak keep, it seems to have been discussed by reputable, non-crazy people. The article needs to be cleaned up, with an explanation near the top of the article that it is a disproven theory. I don't think the link to the book should be included, as it appears to treat the theory as true and seems to have been link spammed all over the place. -- Kjkolb 00:48, 8 November 2005 (UTC)
      • Delete, as per CH's argument below. -- Kjkolb 22:08, 9 November 2005 (UTC)
  • Comment. The evidence of OR is possibly true, however there is a body of abstracts and research being done on this topic outside of Mr. Bird. The current article, if kept, needs to be tagged because it is a load of drek, but the concept in and of itself seems notable even if it is eventually discredited.--Isotope23 17:27, 7 November 2005 (UTC)
Kjkolb and Isotope23, I wonder if you missed my point. There are certainly well-defined scalar theories of gravity (I mentioned one in my discussion in the talk page), and there are also various scalar fields (but that is something else) discussed in general relativity and in other classical relativistic theories of gravitation, but the author of the article provided no citations in the reputatable research literature for the theory he wishes to discuss, and on the basis of his description, his account does not appear to me to define a theory at all, much less a viable one. So if you searched the arXiv for scalar gravity or scalar, I don't doubt that you found hits, but I do question whether you found discussion of the alleged "theory" our anonymous editor is trying to describe in this article. This is why I have nominated it for deletion: it appears to describe as a viable gravitation theory some "theory" which does not appear to be sensical, and for which the author of the article is apparently unable to provide citations to the research literature in physics. In fact, as I explained in the talk page, it appears likely that the only place where this "theory" is discussed is a web page, apparently put up by the very same person who wrote the article. Hence my invocation of WP:NOR. So my question for you two is: are you sure you found independent discussion in the research literature of the precise "theory" that the author is trying to describe? If so, can you please share the citation?---CH (talk) 02:36, 8 November 2005 (UTC)
Sorry, I guess I was unclear. My vote was based on the fact that scalar gravity as a subject, exists and is notable, not that this particular theory of scalar gravity is in anyway right or notable. I found no evidence that this theory is right. I did see the website and it appears to be nonsense, though I'm far from an expert. I suggest that the article be entirely rewritten, so that it discusses the scalar gravity theory that Einstein and Feynman were talking about, not this theory. If this is not possible, it should be deleted. What do you think? -- Kjkolb 03:28, 8 November 2005 (UTC)
And I mirror Kjkolb's sentiment. The article may be factually inaccurate, but since there IS a theory of Scalar Gravity that is generally accepted to exist, this is a good candidate for a cleanup and keep job, with the text of the article being replaced with a factually accurate document based on the body of research I mentioned above. I'd do it, but I'm not exactly an expert at physics so chances are any article I wrote would be riddled with mistakes. Long story short, I can't vote delete on a notable subject, even if the current article has serious problems.--Isotope23 03:39, 8 November 2005 (UTC)
OK, I think I've finally cleared this up in a separate discussion with Isotope23, but for other readers, just to clarify: the statement that there IS a theory of Scalar Gravity that is generally accepted to exist is misleading. The key points are:
  1. There is no theory (not even a failed theory) which is known in the physics literature simply as 'Scalar Gravity', and as far as I can see, the article disucusses an ill-defined 'theory' which is unknown to physics.
  2. There are certainly well-defined Scalar theories of gravitation, and this topic is noteworthy if for no other reason than to
    • examine some simple theories of gravitation, such as the Watt-Misner theory I mentioned on the talk page, which are of pedagogical interest as theories which can, fairly easily, be shown not to be consistent with solar system observations,
    • explain some arguments why no pure scalar (or pure vector) theory of gravitation is viable.
  3. The text of the article Scalar Gravity contains (as far as I can see) nothing worth keeping; even the title violates Wikipedia capitalization conventions. So anyone writing an article on the topic which we agree is notable, Scalar theories of gravitation, would have to begin by wiping the article and moving the page to a page with the new title. It seems simpler to delete Scalar Gravity and start again with Scalar theories of gravitation.
I can suggest two recent articles which would probably be useful to anyone starting to research theories of gravitation which are known in physics:
  • Template:Web reference author
  • Template:Web reference author A 2005 update can be found here.
Unfortunately, because pure scalar theories of gravitation are known to be nonviable, discussions of them are harder to come by, but some examples are:
MTW is the textbook by Misner, Thorne, and Wheeler cited in General relativity resources, and features a much-quoted discussion of scalar theories and vector theories (non-viable) versus tensor theories and scalar-tensor theories (some of which are viable as fundamental theories of gravitation).---CH (talk) 21:43, 9 November 2005 (UTC)
Isotope23 - I do sympathize with you, but I think that we should either put up to shut up. This article cannot be kept in its current form, and I am not in a position at this time to edit it, being in the middle of a business trip. Hence my weak delete vote. I will happily change in to a keep, but only if the article changes. In the meantime, what is there has "OR" written all over it, and that must be dealt with one way or the other. --EMS | Talk 07:43, 8 November 2005 (UTC)
  • Keep. The article makes it clear that this is a mathematical theory which was considered by Albert Einstein before he came up with General Relativity. Therefore it is quite right to have an article about it. The article also makes it clear that the results of so-called Scalar Gravity do not agree with experiments. Further it makes clear that in order to test the GR concept of curved space you need a flat-space alternative to compare it to. There is no reason not to talk about this theory in case people mistake it as a true picture of reality. The article also has links to research published in physics journals which use scalar gravity.
The article does need more background and someone should add to it to supply such a background and why GR finally triumphed as the true theory.
I think this article could potentially be very interesting as a history of scalar theories of gravity. Although it does need much work. However I do not believe this is a reason for deletion at this stage.
—Preceding unsigned comment added by 62.137.135.0 (talk • contribs) 18:12, 7 November 2005
I wish you had signed this comment, whoever you are, but my problem with this is that the author presented no evidence for his claim and I don't think this claim is true. Again, please note that scalar theories were known to Einstein, but not, as far as I can tell, this "theory". Indeed, while there are well defined (but non-viable) scalar theories of gravitation, this "theory" is not one of them, as far as I can tell from the author's incomplete description. Again, the key point is: there are genuine gravitation theories which are notable, but the author of this article appears to be discussing a "theory" which is (a) nonsensical (b) uknown in physics, and therefore non-notable.---CH (talk) 02:36, 8 November 2005 (UTC)
  • Delete. As-is it's a lecture and goes into massively more detail than a general readership will ever want. A summary could be merged into related topics, I guess. - Just zis Guy, you know? [T]/[C] :: AfD? 18:53, 7 November 2005 (UTC)
  • Keep. Where does minutae belong if not in an encyclopedia? It's clearly labeled as not in congruence with accepted theory and if anyone does indeed use it (as the article claims, even though the theory is flawed) it belongs here. Ifnord 22:08, 7 November 2005 (UTC)
But Inford, the problem is that this particular scalar theory of gravitation is apparently nonsense (not a "theory" at all). No-one questions that other theories, ones which have been seriously discussed at one time or another in the research literature, or which have some pedagogical virtues, would be notable, but this article contains nothing on which we can build to write an article discussing those theories. I hope you will reconsider and change your vote.---CH (talk) 02:36, 8 November 2005 (UTC)
Your point is valid, I now understand what you mean. However, I am swayed by Isotope23's position that the article itself is noteworthy even if the content is flawed at the present time. I will remove my vote altogether. Ifnord 04:59, 8 November 2005 (UTC)
  • Delete Wikipedia is not an indiscriminate collection of information, and the article is OR. - Dalbury (talk) 23:52, 7 November 2005 (UTC)
    • Keep as rewritten, and move if appropriate. - Dalbury (talk) 16:15, 12 November 2005 (UTC)
  • Keep provides some historical context and is worth keeping even with a cleanup and NPOV tag. Hopefully somone could come along and reasearch the topic. Falphin 02:51, 8 November 2005 (UTC)
  • Comment Some above have argued that this article should be kept because there is a scalar theory of gravity, whatever problems there are with this article. There are in fact many scalar theories of gravity, most of which fail completely to meet general scientific standards, or to actually explain anything about gravity. I remember reading somewhere (sorry for the lack of citation here) that scientific journals receive more unpublishable (i.e., 'crackpot') manuscripts on theories of gravitation than on any subject other than perpetual motion. There are many self-published 'crackpot' theories of gravity out there, so getting many Google hits does not establish the viability of this or any other theory of gravity. In this case, I think the very elaborate formulas which have no explanation of what most the terms mean or why they are used in the formula, forces me to regard this article as nonsense. There might be justification to mention this particular theory, along with many other such theories, in an article on alternative theories of gravitation that are not accepted by the scientific community. As it stands, however, this article does not belong in Wikipedia. - Dalbury (talk) 10:48, 8 November 2005 (UTC)
    • There are many theories and the notable ones should be mentioned. Just becasue the article is incomplete doesn't make it unencylopedic. It has a good amount of google hits which established notability it may not estabish viability but that doesn't matter. The topic is still notable. I do believe the article belongs in wikipedia but it needs cleanup and neat NPOVing. Falphin 22:21, 8 November 2005 (UTC)
      • Comment. If there is going to be an article on scalar gravity, then it will need to discuss: scalar gravity with preferred frame[35], tensor-scalar gravity[36], relativistic scalar gravity[37], general Lorentz-invariant scalar gravity[38], Maxwell-scalar gravity[39], and others I didn't take time to look up. As the title of Scalar Gravity does not conform to Wiki naming standards (it should be Scalar gravity, as the theory presented is not the only theory of scalar gravity), I believe it would be best to delete this article and let someone who knows their way around these theories create a review article of the better known theories of scalar gravity. - Dalbury (talk) 23:21, 8 November 2005 (UTC)
  • Comment I disagree with CH in that he claims that the article is about a non-sensical theory since the idea of describing gravity as a scalar field is clearly sensical and was known even to Isaac Newton. The point about the theory being non-scientific also baffles me as it clearly is about a testable theory. The point that this is not the scalar gravity theory that Einstein considered is also not true. Perhaps CH could make a link to the theory that he thinks Einstein did consider? I had a link to an article about how Einstein found General Relativity which would have cleared the matter up but I lost it! Sorry.
But this is all besides the point. The question is not whether the theory works or not. Otherwise, some might argue, there should not be an article on Communism because it is a 'crackpot' theory. The question is whether the article accurately documents this mathematical theory, which has historical interest, which I believe it does. -P
—Preceding unsigned comment added by 62.137.134.120 (talk • contribs) 14:55, 8 November 2005
62.137.134.120, whoever you are, you seem to think that I said "no scalar theories of gravity are well-defined", but I never said that and it isn't true! In fact I specifically mentioned a scalar theory which is well-defined. What I said was that scalar theories in general are known to be nonviable, I was referring to very well known arguments sketched the very widely read textbook by Misner, Thorne, and Wheeler (see General relativity resources). Please read this discussion before creating any more articles on gravitation theory in the Wikipedia, since these are elementary and crucial points.
You claim your article accurately documents this mathematical theory, but citing a web page is not the same as citing a paper published in a reputable research journal, or a widely-used standard graduate level textbook such as MTW. Indeed, I claim that your "theory" as you described it is not even well-defined, so I claim that it is not a theory at all, as phycisists understand that term, at least not yet. Here's what I suggest:
  • fix the problems I pointed out at your own website or wherever,
  • concoct a reason why your fixed up theory might be of interest, despite being nonviable (as any scalar theory must be),
  • submit a paper to a reputable research journal in physics such as Classical and Quantum Gravity or General Relativity and Gravitation,
  • await papers by other authors building on your work,
  • if sufficient interest is generated, watch as some third party eventually independently decides to write an article on this (so far entirely hypothetical) body of literature.
See what I am saying? Science might sometimes seem to work slowly on human scales, but its self-correcting nature is probably the best thing about it, so we need to foster this process of error detection and eradication, even if our own "children" are numbered among its "victims". Fair enough? ---CH (talk) 22:01, 9 November 2005 (UTC)
P.S. The scalar theory of gravitation which played a role in the birth of gtr which you had in mind is probably Nordström's theory of gravitation; see also the citations in that article.---CH (talk) 22:12, 9 November 2005 (UTC)
  • Delete unless substantially rewritten, basically per CH. The article does not cite any references, bar one which seems to describe a different scalar theory of gravity. Yes, it may be true that an article on scalar gravity is warranted, but the current article is not suitable. More importantly, when somebody will start to write the article on scalar gravity that we want, the current article will be of no help, and it will confuse readers in the meantime. The author says: "The question is whether the article accurately documents this mathematical theory, which has historical interest, which I believe it does." It is not enough that the author believes so, we need to see some evidence of it. -- Jitse Niesen (talk) 15:33, 8 November 2005 (UTC)
    • Keep and move to scalar theories of gravity now that EMS has rewritten the article to get rid of the original research. Thanks! -- Jitse Niesen (talk) 13:53, 12 November 2005 (UTC)
  • Delete, as per CH. Its rather cleverly written, using all the standard catch-phrases and symbols of physics, so if you skim it, it looks good. But the action is strange, with the phi^-1 in it, and no discussion of how that can be. I'll side with CH until some book reference is given that has this action in it. linas 01:10, 10 November 2005 (UTC)
Oh, well, Brans-Dicke has a phi^-1, so I dunno. Still want a book reference. linas 01:17, 10 November 2005 (UTC)




Comment If people are going to reject an article as crackpot then they shouldn't give crackpot reasons. From what I've read above it appears as if none of the commenters have a remote understanding of General Relativity or even basic A-level mathematics. I get the feeling that most of those objecting to this are interested amateurs who have read a few articles on the matter. I would suggest that those who strongly object should give references of their authority in the matter. Otherewise I can only assume that most of the abbusive commenters above are 13 year old boys who think they know more than they actually do. I have to say that using the abusive terms of some of the above that a lot of the comments are absolute "drek" whatever that is. Some new schoolboy slang term I expect. But I have to say that if these are the kinds of people who read wikipedia then I'm sure the article has no point being there otherwise it is simply being read by complete morons. So I vote for delete not because the article is wrong but that it is too good to be read by such loonatics. Honestly people like CH should have better things to do than accuse people of killing their children by reading an article on gravitational theories. CH I advise growing up, going to university, and actually learning about what you think you already know but clearly don't. —Preceding unsigned comment added by 62.137.135.52 (talk • contribs) 16:52, 10 November 2005

  • Please do not make personal attacks. See Wikipedia:No personal attacks. -- SCZenz 18:08, 10 November 2005 (UTC)
  • Also see WP:CIVIL. And, incidentally, most of the people who have voted delete, from my observations, have clear experience with a broad range of topics in modern physics. (You can see Dr. Hillman's qualifications and experience from his user page, for example.) I will assume good faith and assume you didn't realize this. -- SCZenz 18:13, 10 November 2005 (UTC)
  • Comment. Since I used the word "crackpot" I think I should reply. I did not call you or your theory "crackpot". I was making the point that there are so many hits for "scalar gravity" on the Internet because there are so many self-published "crackpot" theories out there. If I did give you the impression that I was calling you or your theory "crackpot", I apologize. I do take offense at the tone of your comments about those of us who have expressed opinions against this article. Wikipedia is not a peer-reviewed scientific journal. All members of the Wikipedia community are entitled to express their opinions on articles entered into Wikipedia. If you want your article to be commented on only by qualified physicists, then submit it to a peer-reviewed journal. If it is published in a peer-reviewed journal, then someone can write an Wikipedia article about the theory. Oh, and by the way, I'm 62, and although I was a physics major for only two years, I continue to maintain an active interest in all fields of science, so I guess that makes me an "interested amateur". - Dalbury (talk) 18:21, 10 November 2005 (UTC)
  • The most abusive writing on this page is that of the anon above! Indeed, I find his accusation that Chris does not know his stuff to not just be rude but also another red flag that there is something very wrong about this anon. That Chris took one look at this article and posted an AfD on it speaks on its being deficient. I am not as capable as Chris, but the more I look at it the more problems that I see, with most of this article being so dense that it is useless as a part of Wikipedia even if it was right. Perhaps the biggest red flag is that this article remains without a References section, and its one referece (a link almost hidden in the introdcution) does not cover the material in this article. I stand by my vote. --EMS | Talk 20:58, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:11, 13 November 2005 (UTC)

[edit] SharpeNews

Non-notable website, vanity article. Hitchhiker89 17:34, 7 November 2005 (UTC)

  • Delete. No Alexa ranking; delete per nom. BrianSmithson 18:13, 7 November 2005 (UTC)
  • Delete. per nominator. *drew 01:08, 8 November 2005 (UTC)
  • Delete per nom --Rogerd 03:37, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:38, 13 November 2005 (UTC)

[edit] Shattered Hand

This was originally listed by Sycocowz on 01 Nov, but the nomination was formatted incorrectly (there was no heading or any reference in the page as to which article it was that was being nominated). I'm correcting the formatting now, and relisting this under 07 Nov. Just completing the nomination, no vote. - ulayiti (talk) 00:40, 7 November 2005 (UTC)

  • Delete 95% Original Research, not encyclopedic by any standard of Wikipedia Sycocowz 17:36, 1 November 2005 (UTC)
Everything after the first two paragraphs is not documented in any published forum and is likely from all Primary Sources >> Wikipedia:No_original_research As far as I can see no other WoW server has its own Wikipedia article nor do I believe it deserves one in the spirit of "Wikipedia is not an indiscriminate collection of information" (debate this if you feel it does deserve one) Sycocowz 01:47, 2 November 2005 (UTC)
  • Can you prove this? Well sycocows i might add you read carefully what standed wikipedia is before you lodge such a delete. Please also give evidence to prove your statement. --Franco rosi 23:25, 1 November 2005 (UTC)
  • Documented online... A great deal of this information is documented on Blizzard Entertainments own forums and verified by Blizzard Employees, and they do seem to constitute an authority over virtual events that occur on their servers. It would seem that - like a sporting event or scrabble tournament, that the facts reported herein are mostly verifiable. There is a need to clean up some issues, like the statement at the end that one person is a racist. Other than that it seems that the entry shouldn't be marked for deletion. I see no reason for deletion. --BusterGT 14:25, 2 November 2005 (UTC)
Blizzard has a policy wherby they refuse to acknowledge kills etc. I agree that 'blue' posts verifying any of the presented information would be acceptable, but I have never seen any post from Blizzard ever verifying anything other than the server exists and the etymology of its name. They did sticky a list of guild websites, this does 'confirm' their existence but has no official information about them. http://forums.worldofwarcraft.com/board.aspx?fn=wow-realm-shatteredhand Sycocowz 20:11, 2 November 2005 (UTC)
Don't get me wrong, I've played on shattered hand since release day. I have no doubt in my mind that most of those things are true. They are completely unverifiable for the purposes of wikipedia however. Internet forums are most certainly not a credible source of anything (blue posts excepted) Sycocowz 12:20, 3 November 2005 (UTC)
  • Delete as not encyclopedic. - brenneman(t)(c) 01:08, 7 November 2005 (UTC)
  • Delete as unverifiable. 68.255.173.215 calls it "almost completely accurate." I'd like to delete the inaccurate parts. Unfortunately, without source citations I have no way of telling which parts these are. Therefore, I vote to delete the entire article. BusterGT says this is "documented online" but does not provide the documentation. Citing sources does not mean asserting that sources exist and that a reader could find them if they looked: it means providing those sources in a way that any reader can check. "Ask anyone" is not citing a source. If the article is edited to include good, verifiable source citations for the important content, I will withdraw my deletion vote. A "good source" would of course be one with a real-world name and identity, not just an online screen name. Dpbsmith (talk) 01:33, 7 November 2005 (UTC)
  • Delete as unencyclopedic and unverifiable. - A Man In Black (conspire | past ops) 04:36, 7 November 2005 (UTC)
  • Unsure -- I'm not yet qualified to vote in this case, but... somebody put a lot of work into it. I've seen worse writing. And whatever World Of Warcraft is, it sure sounds exciting. Before deleting, I might ask myself: is it certain that no one will ever find this info useful?
  • Delete as unverifiable and unencyclopedic. WP:NOT a history of every gaming server ever booted up. In 100 years, nobody will care that "On a daily basis, Jubei, the infamous leader of Skyfang, and his guild would invade the Horde city of Thunderbluff to kill the NPC boss Cairne Bloodhoof in order to gain honor, mostly uncontested." Hell, nobody will care in a year. FCYTravis 07:26, 7 November 2005 (UTC)
  • Delete As per FCYTravis... Marcus22 10:22, 7 November 2005 (UTC)
  • Delete. Wouldn't belong in an encyclopedia even if it was verifiable. Belongs deleted like fancruft and forumcruft. — Haeleth Talk 16:39, 7 November 2005 (UTC)
  • Delete per Haeleth... no reason for a whole article of fancruft history of one WoW server, even if it is 100% WP:V. Didn't sign my vote --Isotope23 04:00, 8 November 2005 (UTC)
  • Delete per nom. burn the fancruft! burn! burn! - Just zis Guy, you know? [T]/[C] :: AfD? 18:54, 7 November 2005 (UTC)
  • Delete per nom. We ought to have a guideline that any AFD discussion which attracts at least 3 sockpuppet votes is automatically deleted :) ESkog | Talk 20:47, 7 November 2005 (UTC)
    • I agree! Dpbsmith002 20:62, 1 April 2020 (UTC)
    • Me too! DoPpelgangerBSmith 20:71, 1 April 2020 (UTC)
    • You can say that again! Real User 20:86, 1 April 2020 (UTC)
      • We ought to have a guideline that any AFD discussion which attracts at least 3 sockpuppet votes is automatically deleted :) ESkog Talk20:89, 1 November 2020 (UTC)
    • Amen. And a vote for delete while I'm here. Ifnord 22:12, 7 November 2005 (UTC)
    • Shoo, I was the only one against the sockpuppets for a bit, got a little scared! Sycocowz 23:10, 7 November 2005 (UTC)
    • To quote William the Concurrer, "I agree". - Marionnette de Chaussette 11:05, 8 November 2005 (UTC)
  • Delete. Unencyclopedic fancruft. jni 06:42, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:10, 13 November 2005 (UTC)

[edit] Shattered Hand guild Stoic

Non-notable, not verifiable etc. see discussions of similar articles Wikipedia:Articles for deletion/Tarquinas Legion, Wikipedia:Articles_for_deletion/Shattered_Hand Sycocowz 23:19, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedied under G3 for being a complete and utter hoax. Trust me on this one, it's not a Swedish word. :) - ulayiti (talk) 18:03, 8 November 2005 (UTC)

[edit] Shmoley

The moment I read the the words Holy Shmoley in the article, I suspected a hoax and I was unable to verfiy the existance of this supposed Swedish food. Caerwine 03:02, 7 November 2005 (UTC)

  • Delete as hoax, multiple google searches proved fruitless. If any Swedish user mentions proof of these "shmoleys", I'll gladly eat my words. --anetode¹ ² ³ 03:57, 7 November 2005 (UTC)
  • Delete as hoax and subtle vandalism. Superm401 | Talk 04:14, 7 November 2005 (UTC)
  • Delete. "Shmoley" is not a likely Swedish language word. Down the flushbusinessatory with it. Anthony Appleyard 06:38, 7 November 2005 (UTC)
  • Shmelete this hoax. u p p l a n d 06:54, 7 November 2005 (UTC)
  • Shpeedy delete this hoax. Ifnord 22:20, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:09, 13 November 2005 (UTC)

[edit] Shuttle-um

private transit service is not notable

  • Delete; per nom (though I was a frequent rider). -James Howard (talk/web) 14:25, 7 November 2005 (UTC)
  • Delete nn student bus service (perhaps worth a footnote in the UM article) Just zis Guy, you know? [T]/[C] :: AfD? 17:44, 7 November 2005 (UTC)
  • Keep any verifiable material, otherwise redirect to the type of transport, or private facility. Notability is not part of deletion policy. Trollderella 19:54, 7 November 2005 (UTC)
  • Delete nn bus service --JAranda | watz sup 01:22, 10 November 2005 (UTC)
  • Delete advert --Rogerd 03:45, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:02, 13 November 2005 (UTC)

[edit] Sinophile

This article is a dicdef, and essentially duplicates the existing Wiktionary entry. It should be deleted. NatusRoma 02:47, 7 November 2005 (UTC)

  • Delete as dicdef. - Dalbury (talk) 18:30, 7 November 2005 (UTC)
  • Delete per nom. Paolo Liberatore (Talk) 19:43, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. - Mailer Diablo 09:01, 13 November 2005 (UTC)

[edit] S.M.F.

copyvio, fails wp:music BeteNoir 05:36, 7 November 2005 (UTC)

  • SpeedyDelete per nomination. - BeteNoir 05:36, 7 November 2005 (UTC)
  • I removed the lyrics, so it's no longer copyvio. Delete anyway. —Ilmari Karonen (talk) 00:16, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:08, 13 November 2005 (UTC)

[edit] Society for the Transmundane And Gifted (STAG)

Unencyclopedic organization with no claim to notability. Web site is on Tripod. FCYTravis 07:22, 7 November 2005 (UTC)

  • delete per nom.—Gaff ταλκ 07:35, 7 November 2005 (UTC)
  • Delete per nom. and zero hits on Google. - Dalbury (talk) 00:28, 8 November 2005 (UTC)
  • Delete per nom. It seems this page isn't going to last very long. Not ready for Wikipedia? Tratos 01:02, 9 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was speedy deleted by Denelson. FCYTravis 07:29, 7 November 2005 (UTC)

[edit] Soma Forum

Vanity. - Evil saltine 04:40, 7 November 2005 (UTC)

Speedy deleted.  Denelson83  04:44, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:16, 13 November 2005 (UTC)

[edit] Soma forums

Vanity (but bigger than the previous one, I don't think this fits under speedy delete). - Evil saltine 05:15, 7 November 2005 (UTC)

  • Delete non-notable. no Alexa rank, 193 members, clearly fails proposed Wikipedia:Websites criteria. --W.marsh 05:34, 7 November 2005 (UTC)
  • Delete, still not 300 members, so delete per precedent. — JIP | Talk 06:26, 7 November 2005 (UTC)
  • Delete. Non-notable, advertising, fail WP:WEB. *drew 07:18, 7 November 2005 (UTC)
  • Delete nn. Dottore So 11:57, 7 November 2005 (UTC)
  • Speedy delete nonsense. ➨ ❝REDVERS❞ 22:07, 7 November 2005 (UTC)
  • Speedy as per Redvers. Sango123 (talk) 22:30, 7 November 2005 (UTC)
  • Speedy as nonsense. Also, anons are vandalizing the page and removing the deletion notice.--Shanel 22:57, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:43, 13 November 2005 (UTC)

[edit] Soup alla Nazionale

Already transwiki-ed, no possibility for expansion into encyclopedic entry. brenneman(t)(c) 01:15, 7 November 2005 (UTC)

  • Speedy delete per A5. Ingoolemo talk 08:14, 7 November 2005 (UTC)
  • (Speedy) Delete as above. NSLE (讨论) \<extra> 08:34, 7 November 2005 (UTC)
  • Delete per nom. What, we have recipecruft now? What next? - Just zis Guy, you know? [T]/[C] :: AfD?
  • Delete per nom. Per Just zis Guy, you know?s concern, I concur - do these people not know where allrecipies.com can be found? Should we tell them? KillerChihuahua 00:39, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP (even discounting the IP, it's still 3 keep, 1 delete, making 75% keep). Robert T | @ | C 03:07, 13 November 2005 (UTC)


[edit] Steve Nguyen

This afd nomination was incomplete. Listing now. —Crypticbot (operator) 12:25, 7 November 2005 (UTC)

  • Keep Appears to be both notable and verifiable. --JiFish(Talk/Contrib) 16:11, 7 November 2005 (UTC)
  • Keep [[40]] There's proof he is legit. Someone's been messing with his profile on imdb also. 18:13, 7 November 2005 (UTC)
  • Keep, as mentioned above. PJM 19:18, 7 November 2005 (UTC)
  • keep please this person is important Yuckfoo 01:19, 8 November 2005 (UTC)
  • delete This person is a voice actor in videogames, and has appeared in a handful of TV bitparts. I've read the IMDB entries, and don't see why this wikipedia article isn't non-notable vanity. Yuckfoo, I don't see how this person is important. If he deserves an encylopedia entry then so does every human being whose existance can be verified. Pete.Hurd 22:49, 12 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:04, 13 November 2005 (UTC)

[edit] Stickblade Incorporated

Clearly a vanity page. The linked article (for the 'CEO') is also a vanity page.

Ironically, 'Stickblade incorporated' doesn't even seem to be a registered business name in California. It is perhaps just a 'made up' name rather than the name of a stand-alone corporation.

If this is the case, then clearly it cannot have a CEO either! —Preceding unsigned comment added by 210.56.73.124 (talk • contribs) 09:38, 7 November 2005 (UTC)

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:25, 7 November 2005 (UTC)
  • Delete. I used to work a web service firm in LA that had bigger clients than these guys and there's no Wikipedia page for them. Note that the nomination was blanked by User:216.154.254.132, whose only contributions are to this article, Steve Nguyen, and their respective AFD nominations. --howcheng [ t • c • w • e ] 19:18, 7 November 2005 (UTC)
  • Delete vanity --Rogerd 03:46, 10 November 2005 (UTC)
  • delete as per nom Pete.Hurd 22:43, 12 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete.  Denelson83  21:14, 12 November 2005 (UTC)

[edit] Suguric Nytroxism

Hoax. One dubious Google hit. -- RHaworth 12:22, 7 November 2005 (UTC)

  • Delete per nom.Paolo Liberatore (Talk) 18:15, 7 November 2005 (UTC)
  • Delete hoax JFW | T@lk 01:35, 8 November 2005 (UTC)
  • Delete per nom FRS 01:40, 8 November 2005 (UTC)
  • Delete per nom BeteNoir 09:08, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:04, 13 November 2005 (UTC)

[edit] Takran

MMORPG, seems non-notable. 500 Google hits for "Takran MMORPG". The game is still under development, too, and I couldn't even access the web page to which the article links. Delete. Joel7687 13:35, 7 November 2005 (UTC)

  • Delete, MMORPGs in development, hosted on free webhosts hidden by free domain name providers probably don't quite reach the level we're aiming for at Wikipedia. fuddlemark (fuddle me!) 14:32, 7 November 2005 (UTC)
  • Delete, but it's a tough call. All it needs is finished software, its own servers, a few thousand users, a widespread fanbase and a couple of years of history... - Just zis Guy, you know? [T]/[C] :: AfD? 18:19, 7 November 2005 (UTC)
  • Delete. We can talk once it goes live and we see how popular it gets. BrianSmithson 18:27, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:45, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was SPEEDY DELETE. — JIP | Talk 13:20, 7 November 2005 (UTC)

[edit] Tanya anya bee

appears to be a vanity page jfg284 12:47, 7 November 2005 (UTC)

  • Delete per nomjfg284 12:47, 7 November 2005 (UTC)
  • Delete. Added speedy deletion tag on joint rounds of vanity and nonsense. Flapdragon 13:17, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete as vanity. - ulayiti (talk) 13:33, 13 November 2005 (UTC)

[edit] The Badboy

Nonnotable performer, vanity article, see also Karaoke Badboy, Delete. Dvyost 07:34, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:03, 13 November 2005 (UTC)

[edit] The Charlie Bryant Tribute Band

non notable...google returns zero hits, currently looking for record deal jfg284 22:27, 7 November 2005 (UTC)

Delete per nomjfg284 22:27, 7 November 2005 (UTC)

The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was that there seems to me to be no consensus; therefore, the result is to keep the article. In addition, given that two closings have been reverted already (and discussion of this had alerted me to this AfD), I am very much tempted to protect this AfD page if it happens again. Please don't play silly buggers. James F. (talk) 17:29, 13 November 2005 (UTC)

[edit] The College of Wooster Greeks

This article has been on AFD twice, Wikipedia:Articles for deletion/The College of Wooster Greeks and Wikipedia:Articles for deletion/The College of Wooster Greeks (2). The first AFD resulted in a no consensus type keep. The second was closed speedily with the rationale that it was a premature renomination. However this speedy keep was disputed and after discussion at WP:DRV there was a consensus for this to be relisted. My vote is below. Sjakkalle (Check!) 16:35, 7 November 2005 (UTC)

  • Keep. Fraternities(sororities and similar are not usually worthy of separate articles, even though such institutions are a part of student life. The presence of this list discourages creation of individual sororities at this college, and as long as all this info is consolidated into one article it doesn't do much harm. Sjakkalle (Check!) 16:35, 7 November 2005 (UTC)
  • Just keep the damn thing. By the way, "no consensus" on deletion means "keep" - David Gerard 16:58, 7 November 2005 (UTC)
    • No, "no consensus" means "no consensus". Not that difficult, really. --Calton | Talk 00:38, 8 November 2005 (UTC)
  • Keep. Perfectly good article, well researched. --Tony SidawayTalk 17:01, 7 November 2005 (UTC)
  • Delete - I voted to delete before. I just don't think that a list of fraterities or societies at a university is encyclopedic. - Hahnchen 17:05, 7 November 2005 (UTC)
  • Delete. A listing of fraternities or sororities at a small college is nowhere near being encyclopedic. To quote Gamaliel from somewhere else:
    • Wikipedia is not paper, but it is also not the Library of Babel, nor is it an endless and tedious compendium of every bit of trivia and gossip and useless, insignificant "facts". It is an encyclopedia, not a dumping ground. That means we have a duty not to mindlessly compile facts but to present them in a concise and usable manner, making judgments about which facts are important and which are not. - Gamaliel --Calton | Talk 00:38, 8 November 2005 (UTC)
  • This list isn't concise, important, or useful. --Calton | Talk 00:38, 8 November 2005 (UTC)
  • keep please wikipedia is not paper but it is supposed to be a sum of human knowledge thats what we advertise Yuckfoo 01:19, 8 November 2005 (UTC)
  • Delete. Wikipedia is not supposed to be the sum of human knowledge per Wikipedia is not an indiscriminate collection of information. Edwardian 04:33, 10 November 2005 (UTC)
  • merge into main school article Tedernst 20:30, 10 November 2005 (UTC)

(Comments within this area are copies of those made by participants in the second AFD; they were pasted here by User:Snowspinner. Editors may wish to comment anew, or simply let their original remarks stand. If new remarks and/or votes are placed, it might be a good idea to strike out the old or note changes apporpriately. I have restored two new comments deleted by Snowspinner, that of Just zis Guy, you know? (who had not participated in the second nom) and Unfocused. encephalon 18:25, 7 November 2005 (UTC))

  • Strong Keep irrespective of any possible failings it survived Afd in September Dlyons493 Talk 21:29, 22 October 2005 (UTC)
    • That has no bearing on its current nomination. The vote resulted in no consensus. User:Purplefeltangel/sig 21:44, 22 October 2005 (UTC)
      • The default is "keep" - David Gerard 21:56, 25 October 2005 (UTC)
  • Merge with The College of Wooster after some snipping. --MacRusgail 22:13, 22 October 2005 (UTC)
  • Delete, collection of fraternity trivia. Pilatus 22:58, 22 October 2005 (UTC)
  • Comment This could be an interesting subject. I know people who went there, and supposedly Wooster didn't have nationals for decades because of a bequest from a former student that had been badly hazed that conditioned the money on no frats. I don't know the exact story, but it did lead to lots of oddities in Wooster Greek life, like no real houses (just halls in particular dorms, usually the bad ones). A2Kafir 23:12, 22 October 2005 (UTC)
  • In an effort to build consensus I'm voting delete per nomination this time. --Metropolitan90 00:08, 23 October 2005 (UTC)
  • Delete nn.  Grue  18:33, 24 October 2005 (UTC)
  • Keep - Wooster does in fact have an unusual history of fraternities, and this article is a reasonable spin-off of the main article. Snowspinner 21:52, 25 October 2005 (UTC)
    • Additional comment - the creator of the article, in the first deletion debate, notes that he made a trip to special collections to verify his facts. Which is to say, this article is the product of real work and real research. Yeah, there are more notable topics, and it could be formatted away from a list. But I really wish we would stop rewarding hard work on articles with "Delete nn." Multiple times. Snowspinner 22:18, 25 October 2005 (UTC)
  • Weak delete. The introduction doesn't establish the point of the article, except that a bunch of things are "mysterious," and it's just a list of fraternities with a few incidents of history thrown in. I would not be opposed to a shorter article that was about history, which cited sources for necessary facts about fraternities instead of listing them all. Honestly, this sort of seems to be a FAQ (or correction of common misconceptions, maybe) about the fraternities at the college, but Wikipedia is not an indescriminate collection of information. Am I wrong to vote delete on an article that might be rewritten completely with some of the same content, but is currently not at all an encyclopedia article? -- SCZenz 01:05, 26 October 2005 (UTC)
    • Merge per MacRusgail, after taking out all the lists of fraternities. I see no evidence the history is uninteresting, and there's no reason for the college not to have a section on fraternity history. -- SCZenz 01:07, 26 October 2005 (UTC)
    Keep. Ultimately uninteresting to me and needs some cleanup, (especially in the lead) but should be kept. Unfocused 03:35, 26 October 2005 (UTC) (See Unfocused's new comment below encephalon 18:25, 7 November 2005 (UTC))
  • Comment (no vote). I was the person to nominate this article the first time. I go to this college. I am not a Greek student, but have no problem with Greeks. At the time, the reason why I nominated was because the article was both POV and unverified, and, at the time, it seemed like that wasn't going to change. I had no idea where the author had originally gotten his information. Those two problems were resolved during the first AfD debate. I personally have an appreciation for the article now, though there are still problem areas, but I am not voting; I think my attending the school and my interactions with greeks color my judgment too much. --Jacquelyn Marie 03:42, 26 October 2005 (UTC)
  • Keep this article about some of Wooster's unique history. Stop obsessing over procedure, assume a little good faith, give others a little space to pursue their own interests, and get back to writing articles, mmmkay? Unfocused 17:09, 7 November 2005 (UTC)
  • Keep , unusually for me in the case of student nonse. This is too big to merge into the main article and nobody's going to be sufficiently motivated to scythe it down to the 100 words or so it deserves, so I say leave it but give it a better title e.g.: College of Wooster (Fraternities & sororities). I'd rather we didn't have to have this kind of thing, but there are too many inclusionists to make it likely we'll ever reach a consensus in that direction. Just zis Guy, you know? [T]/[C] :: AfD? 17:10, 7 November 2005 (UTC)
  • Cleanup, the article is currently poorly organized and hard to follow. The first thing it says is there are 10 greek organizations, then it lists many more; Move, the title sucks, call it Fraternities and Sororities at the College of Wooster or something (the current title smacks of subliteracy); Wikify, if any of those are national fraternities (and some claim to be it seems) they probably have articles here already; Verify, I'm not sure a student's independent study can count as a reliable resource, particularly when it seems unlikely to be available for review. Smerge. To help build consensus for a merger, which seems the best comproise. Most of those crossd out comments actually still stand, however (about cleaning and the like). -R. fiend 17:36, 7 November 2005 (UTC)
    • It's more accurate to think of it as a "senior thesis" than an "independent study" - Wooster uses IS to mean something different than most places. The IS program has vetting comparable to MA theses, including oral examination and a second reader, and the resulting papers are kept by the library, making them reviewable/verifiable. Phil Sandifer 17:41, 7 November 2005 (UTC)
  • Merge to College of Wooster. Individual chapters are rarely considered encyclopedic. This topic is fairly obscure so it's not covered in many reliable sources. The most basic, verifiable information should be merged, the rest left out. The current content has improved but it's still not very encyclopedic or well supported. I've already started removing the most obviously inappropriate content. All the "rumored to" and "allegedly" original research should be left behind when merged. Now-defunct local student organizations are of such trivial interest that they're simply not very verifiable. Friday (talk) 17:47, 7 November 2005 (UTC)
The useful parts of this have already been merged, so I guess that makes my opinion delete, for the same reasons given above. Friday (talk) 00:50, 8 November 2005 (UTC)
If I read correctly, your opinion is that the useful parts are "There are currently 10 active greek groups at the College of Wooster, 6 sororities and 4 fraternities?" Phil Sandifer 00:52, 8 November 2005 (UTC)
Yep. Although, come to think of it, I certainly wouldn't be opposed to listing the active ones. Giving much detail beyond that is simply cruft. Friday (talk) 00:55, 8 November 2005 (UTC)
If by "cruft" you mean "something you don't personally care about," sure. Phil Sandifer 01:04, 8 November 2005 (UTC)
Actually, what I meant was more like "excessive amounts of insignificant detail". Of course, this is a pure judgement call. It's the questionable verifiability of all those little details that concerns me most. Friday (talk) 01:10, 8 November 2005 (UTC)
  • Delete I see no indication of encyclopedic significance or notability in this information. There also still seem to be significant verifibility issues, as it is not clear which facts are supported by which sources. If the article is kept, rename and clean up as per User:R. fiend. Better would be a merge of the basic, verifiable information to The College of Wooster if this is not simply deleted. DES (talk) 18:50, 7 November 2005 (UTC)
  • Keep any verifiable material, otherwise redirect to the college. Trollderella 19:54, 7 November 2005 (UTC)
  • Can we just merge this already before somebody creates WP:KAAWNTCOWGFDB2? Radiant_>|< 00:45, 8 November 2005 (UTC)
  • Delete per Friday and Calton. I would normally vote to redirect, as these are very useful in an electronic encyclopedia, but in this case the title is very unhelpful, as R Fiend said. encephalon 00:54, 8 November 2005 (UTC)
  • Comment: I think some people are very confused about what previous Afds mean. "No consensus" means "no consensus", which means the article isn't deleted at that time. So, no consensus results in a keep. But it does not mean "keep". Also, keep in mind the last Afd was improperly tampered with, in an apparent effort to make it look like a keep. Friday (talk) 00:58, 8 November 2005 (UTC)
    • Your first statement is flatly wrong. But your second statement sounds like an accusation - would you care to elaborate? Phil Sandifer 01:21, 8 November 2005 (UTC)
      That's a topic for deletion review, where I already gave my opinion. The relevance I see to this Afd is that the last Afd was irregular and should be taken with a grain of salt. If you want to discuss the last closure in more detail, this isn't the place. Friday (talk) 01:34, 8 November 2005 (UTC)
        • An improper closure and an accusation of vote tampering seem to me to be two very different things. Phil Sandifer 02:18, 8 November 2005 (UTC)
  • Comment "No consensus" means an Afd did not reeach a consensuss. When that happens we keep the article, because there was no consensus to delete it. But it does not mean that there was a clear consensus to keep it -- in many cases it means that there were more people who wanted to delete than to keep, but not enough to form a consensus to delete. And the second AfD was closed before the normal 5-day period was up, in a proceduarally unusual and arguably improper (I argued it on WP:DRV) action. I presume that that action was taken because the closer was convinced that a consensus was already clear, and would not change; and that there was no intent to decieve or distort the results. I think it was ill-advised. DES (talk) 01:29, 8 November 2005 (UTC)
  • That is utter nonsense. Articles are kept unless there is a consensus to delete. A consensus to keep may be formed, but it's quite irrelevant to the deletion policy, which only cares if there's a consensus to delete. An article does not require and has never required a consensus of editors in order to exist on Wikipedia. More to the point, it can easily be seen that after three AfDs there are few if any good reasons to argue for the deletion of this well researched and compendious article. --Tony SidawayTalk 01:49, 8 November 2005 (UTC)
    • Of course not. Any article that merits inclusion in the encyclopedia will have a clear consensus to keep—if an article cannot get that, then it means that there are some problems with it, at least in the opinions of other users. Titoxd(?!?) 04:36, 8 November 2005 (UTC)
  • It is quite correct thst a consensus to keep is never required. However, when an article's AfD results in a clear consensus to keep that article would IMO be less subject to a future delete nomination, at least in the short term, and the appeal to the previous afd debate would be far more persusaive if it were nominated. An appeal to a previous AfD with a non consensus result has far less value, IMO, and i think that is the point Friday was making, or should have been making. DES (talk) 01:57, 8 November 2005 (UTC)
  • Delete The large amount of information that "is rumored," "likely," or "alledged" [sic] seems to violate the idea that WP:NOT "a collection of unverifiable speculation." Trivia such as "Symbol: Steal your Face (???)" seems to violate WP:NOT "an indiscriminate collection of information." Labeling information about hazing as "fun facts" seems to violate WP:NPOV. For example, while it may possibly be a verifiable fact that "[sorority] pledges had to ... write "Peanut" on the butt ... men would then be instructed ... to 'Slap their peanut,'" for editors to label such "facts" as "fun" betrays a certain POV. And "There is a common misconception that the College dosn't have any national fraternities"? I doubt it's that common to have any conception, let alone misconceptions, about fraternities and sororities at Wooster. While I appreciate R._fiend's optimism that attempts to clean-up, move, wikify and verify could save this article, the only info that seems even remotely encyclopedic is that "In 1999 ... the school received national attention when four Kappa Chi members were arrested for hazing pledges by beating them and urinating on them, leading to the eventual ban of the Fraternity." This can be merged with Fraternities_and_sororities#Hazing_issues, the rest can be deleted. Dragonfiend 04:17, 8 November 2005 (UTC)
I agree that some aspects of the article need a lot of work. But the NPOV can be solved with a rewrite, and you can vote keep without necessarily wanting all of the information to stay. You can just be bold and rewrite or remove that section. Jacqui ★ 15:29, 8 November 2005 (UTC)
  • Delete. My decision is based upon the page not the previous AfDs: unverifiable, not notable. It seems that process complaints work only to keep, so to address them: first AfD borderline, second AfD immoderate. Look at the article, we're building an encyclopedia and this isn't that. - brenneman(t)(c) 04:27, 8 November 2005 (UTC)
  • Merge/delete. Dragonfriend is quite correct on saying that several aspects of the article are in violation of WP:NOT, but there are snippets in this article that do merit inclusion in the encyclopedia. That said, they belong at College of Wooster, not here. If a merge is not accepted, then my vote should be read as a delete. Titoxd(?!?) 04:32, 8 November 2005 (UTC)
  • Keep I see absolutely no reason to delete this article.--Nicodemus75 06:28, 8 November 2005 (UTC)
  • Delete or if there is something that could be kept Merge as a part of deleting. This looks like a bunch of data from an infobox for a fraternity or sorority. That data should be listed on the national article. Vegaswikian 06:39, 8 November 2005 (UTC)
  • Delete Fraternity lists are not encyclopedic, and have myriad verifiability problems to boot. Xoloz 10:27, 8 November 2005 (UTC)
  • Comment: a note on verifiability. I can't argue with anyone regarding whether this topic is unnotable or unencyclopedic. Those two are amorphous subjects and everyone has a different view of them. But it troubles me when people say they worry about verifiability. An Independent Study, if you read The College of Wooster article, is not just some final senior paper. It is the second-highest rated senior capstone project after Princeton. As Phil said, it's more like a thesis. I'd like to point out that it's not something a student just writes and hands in and gets a grade. Advisers are involved all the way through; they wouldn't allow unverifiable information to get in. And, as Phil said, it's possible to get your hands on one. I know people would just like to be able to Google this to confirm it, but, as vandals on this site sadly indicate, finding something on the Internet is not a guarantee of its truth. Also, there are plenty of true things that are not on the Internet. And, in conclusion, if you want to help with the verifiability of Wikipedia, go help with Alanis Morissette, which literally has no sources (compared to this one, which is well-sourced) and probably gets looked at about 500x as much. Jacqui ★ 15:26, 8 November 2005 (UTC)
  • Delete per Dragonfriend --JAranda | watz sup 01:27, 10 November 2005 (UTC)
    • Um, I think that's Dragonfiend. -R. fiend 04:05, 10 November 2005 (UTC)
  • Delete per the friendly Dragonfiend. Xoloz 05:56, 11 November 2005 (UTC)
    • Some days are so mind-numbing, you vote twice. :) Sorry. Xoloz 05:58, 11 November 2005 (UTC)
  • Delete per above. Such lists are unencyclopedic imo. Dottore So 10:50, 11 November 2005 (UTC)
  • delete unencyclopedic trivia list Pete.Hurd 22:38, 12 November 2005 (UTC)
  • keep to clarify, yes i created this article. the major source of 75% of the information originaly placed in the article is The Wooster Voice articles on Greek Week 1991 and 1992 published Sept 13, 1991 and Sept 11, 1992 and availible in libraries in Northeast Ohio, special collections at wooster, microfiche at wooster, and from the Wooster Voive itself. The research on the defunct fraternities was done using the Wooster Index yearbooks noted in the article. There is no AfD criterion by which I view this as deletable. Vanity would require me - or anyone who has ever edited the article - to actually be a part of the greek community at that school, which I am not. CastAStone 23:44, 12 November 2005 (UTC)


The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:02, 13 November 2005 (UTC)

[edit] The New Deal (rap group)

This article does not meet criteria established in WP:MUSIC (no national touring, no released material, etc.) Jasmol 07:16, 7 November 2005 (UTC)

  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:26, 7 November 2005 (UTC)
  • Delete per decent nomination. Nice name for a band, mark you. fuddlemark (fuddle me!) 15:28, 7 November 2005 (UTC)
  • Delete per nom. PJM 17:33, 7 November 2005 (UTC)
  • Delete. Found some references on Google, but agree that WP:MUSIC criteria are not met. BrianSmithson 18:35, 7 November 2005 (UTC)
  • Delete, not verifiable. Fredrik | talk 22:06, 9 November 2005 (UTC)
  • Delete per nom --Rogerd 03:46, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 03:02, 13 November 2005 (UTC)

[edit] The Region

Book in which this appears to be mentioned either is NN or doesn't seem to exist. Found a similar one on amazon, but the description doesn't seem to match (though it's not very specific).

  • Delete per nomination. Fallsend 20:05, 7 November 2005 (UTC)
  • Delete minor facet of what appears on the face of it to be a non-existent book. Just zis Guy, you know? [T]/[C] :: AfD? 22:41, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:22, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete.  Denelson83  04:40, 12 November 2005 (UTC)

[edit] The Rolling Stones (film)

A film supposedly scheduled to be released a year from now, although "no studio has given the script the green light yet". No imdb page and the actors and producers are redlinks. Written by a youngster (as the tagline tells us, "the world's youngest filmmaker to date"). Not notable yet. HollyAm 00:10, 7 November 2005 (UTC)

  • Delete Flapdragon 00:30, 7 November 2005 (UTC)
  • Delete, vanity, not a real film. User:Zoe|(talk) 00:31, 7 November 2005 (UTC)
  • Delete as unverifiable. There have been films made about the Stones notably Gimme Shelter and a new film about the death of Brian Jones called Stoned. However, there is no verifiable evidence of this film project either on Google or Google News. Capitalistroadster 00:39, 7 November 2005 (UTC)
  • Delete as above. Pintele Yid 00:39, 7 November 2005 (UTC)
  • Delete as a fabrication. Flowerparty■ 01:37, 7 November 2005 (UTC)
  • Delete. NN, no entry on IMDb. *drew 02:47, 7 November 2005 (UTC)
  • Delete as nonexistent film. Note that one of the proposed cast members is ALF. --Metropolitan90 02:51, 7 November 2005 (UTC)
  • Delete, not a crystal ball or anything. — JIP | Talk 06:23, 7 November 2005 (UTC)
  • Delete, films that have not been given a green light by a studio cannot have a reliable scheduled release date. Also, I find it highly unlikely Daniel Radcliffe will have anything to do with it. He'll be filming December Boys in Australia starting "fittingly" in December and Harry Potter and the Order of the Phoenix will start filming in February. Given the fact that shooting Harry Potter usually takes around a year, a Christmas release of this film is quite impossible if he's a serious candidate. - Mgm|(talk) 08:17, 7 November 2005 (UTC)
  • Delete per above. NSLE (讨论) \<extra> 08:30, 7 November 2005 (UTC)
  • Delete Smells fake, certainly not verifiable. If real, deserves (at most) a sentence or two on the main Rolling Stones page until more finalized, not its own page. Turnstep 15:24, 7 November 2005 (UTC)
  • Delete per nom. As stated above, a release date is scheduled late in the proceedings, not before a studio has even agreed to make the thing! If it's not a hoax it's titanic arrogance. - Just zis Guy, you know? [T]/[C] :: AfD? 18:48, 7 November 2005 (UTC)
  • Delete. No valid reason given for deletion, nonetheless, this does not look independently verifiable. Trollderella 19:28, 7 November 2005 (UTC)
    • The fact that there is no such movie is not a valid reason? User:Zoe|(talk) 03:05, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 01:06, 13 November 2005 (UTC)

[edit] The Shmucks

A bunch of 14 year olds does not a notable band make. Especially when they've broken up already and have never even written anything themselves. I think the name describes them well. Francs2000 03:13, 7 November 2005 (UTC)

  • Delete non-notable, seems to fail WP:Music. --W.marsh 03:17, 7 November 2005 (UTC)
  • Delete per W.marsh --anetode¹ ² ³ 03:51, 7 November 2005 (UTC)
  • Delete per W.marsh.—Gaff ταλκ 07:41, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete. Kirill Lokshin 00:51, 13 November 2005 (UTC)

[edit] Thomaston Cross Country

NN school sports team. Also seems to be vanity.

  • Delete per nom. jnothman talk 02:16, 7 November 2005 (UTC)
  • Delete. Give 'em a sentence in the school's article if/when it has one. -R. fiend 05:41, 7 November 2005 (UTC)
  • Delete NN. Edwardian 07:28, 7 November 2005 (UTC)
  • Delete should be done soon after I delete their no sourced image.  ALKIVAR™ 07:30, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP. Robert T | @ | C 03:01, 13 November 2005 (UTC)

[edit] Three_Dozer_Build

Strategy Is Invalid and Misleading. It is notable in the sense that it was referenced by Pure Pwnage but the people who created this wiki have obviously missed the satire and irony present in their films. This phrases 'common uses' are practically non-existant outside of said film series. This should be deleted and merged with Pure Pwnage if needed. Full analysis at Talk:Three_Dozer_Build Borgs8472 17:53, 7 November 2005 (UTC)

See the previous nomination at Wikipedia:Articles for deletion/Three Dozer Build - Mike Rosoft 19:41, 7 November 2005 (UTC)
I have. The votes are based on thinking that a strategy mentioned in a satircal film is an actual strategy, which it's not Borgs8472 21:20, 7 November 2005 (UTC) Please only make relevant comments to the VfD. Batmanand 01:47, 10 November 2005 (UTC)
  • Delete Google hits make it fairly plain that this is a joke term, per Borgs8472. Merge if there's anything worth having. Just zis Guy, you know? [T]/[C] :: AfD? 22:35, 7 November 2005 (UTC)
  • Keep as per reasons in previous nomination. Batmanand 00:22, 8 November 2005 (UTC)
  • Keep as per the reasons in the previous nomination. TomStar81 03:32, 8 November 2005 (UTC)
  • Keep as per the reasons in the previous nomination. Bastin8 01:45, 9 November 2005 (UTC)
  • Keep as per the reasons in the previous nomination. People know what it is, it's a tactic which can be used in ZH, Pure Pwnage just made it more noticable. I know this isn't the best source, but these guys seem to know what it's talking about, even if they do find it funny that there's an article on it. If the tactic is used commonly then why can't it have it's own article? The simple matter is, it's a strategy which can be used, and the information available for it shows that quite clearly. --Vanguard 04:36, 9 November 2005 (UTC)
Thanks for finding an actual reference. However it's not a common term, the strategy is neither a noob tactic nor ineffective. A further example, if I were to make a wiki on 'pawn to king 4' in a chess game, and claim that people call such players noobs and that that tactic will nearly always lose you the game, that would be comparable to the wiki in question Borgs8472 01:11, 10 November 2005 (UTC)
1. Factual incorrectness is not a reason to delete a page (fix it instead). 2. The "pawn to king 4" example is irrelevant, as it is not a "tactic" and there is already a page on chess openings. Batmanand 01:47, 10 November 2005 (UTC)
Ah, but the term is 'generally' used to refer to new players, it's only saying how the word can be used as well as being used for the name of a tactic. Words have different meanings, they can mean different things when applied to different areas. Further more, if the term is ingrained in the games online culture then surely it has a right to be here? It may not be used all that often but that doesn't mean it isn't used as a derogortory term, or (as the rest of the article clearly states) as a tactic.
Pure Pwnage takes the mick out of gaming culture, which is why it picked up on this. If gaming can be seen as a culture then terms like these can be successfully applied to it.
It seems to me that you seem to be more bothered about the 'Usage' section. The rest of the article simply describes the tactic. As I've said, that's how some people in the game may choose to use it, just like we use words like 'cool' for different meanings. If the tactic is seen to be commonly used by new people then some gamers have formed some sort of cult in rejecting the tactic, and as an online gamer myself I wouldn't find that all that surprising.
The 'Usage' is basically explaining that the term can be used in this way, and if it is then I say no reason why it should offend. If your bothered about it then, by all means, rewrite the section to make it more understandable. --Vanguard 21:31, 10 November 2005 (UTC)
I'll rewrite it, but since there will be no sources for 'common usages' of terms, I'll end up deleting them Borgs8472 22:32, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was KEEP. Robert T | @ | C 02:58, 13 November 2005 (UTC)

[edit] Timbits

This topic is not significant enough for an encyclopedia article. It is a trademarked name for a common fast-food menu item.

  • Delete or Merge relevant info into Doughnut. --Robby 15:38, 7 November 2005 (UTC)
  • Keep. A pretty major piece of Canadian culture, 47,000 Google hits, and a fairly decent article. - SimonP 19:50, 7 November 2005 (UTC)
  • I'm going to vote keep. This item has a prominent place in Canadian culture, sad as that sounds ... CJCurrie 19:52, 7 November 2005 (UTC)
  • Keep. Canadian institution. Have helped keep me awake in numerous tedious all-day-meetings. Luigizanasi 20:01, 7 November 2005 (UTC)
  • Keep, for the aforementioned reasons. Adam Bishop 20:04, 7 November 2005 (UTC)
  • Keep. Sadly, Simon, CJ and Luigi are correct: Timbits do have a prominent place in Canadian "culture". Ground Zero | t 20:06, 7 November 2005 (UTC)
  • Keep. Notable food item.--Shanel 20:16, 7 November 2005 (UTC)
  • Keep. That's like saying that we should merge Big Mac into Hamburger. Hell, even the Google Blog linked to it :) Ral315 (talk) 20:47, 7 November 2005 (UTC)
  • Keep, per SimonP, CJCurrie, Luigizanasi, Ral315—Gniw (Wing) 21:09, 7 November 2005 (UTC)
  • Keep, valid discourse on variance in international gastronomic terminology, disruptive to an overwhelming American bias,never heard of timbits before.." -nvt
  • keep, Ral315 said it best. getcrunk juice 00:49, 8 November 2005 (UTC)
  • KeepI don't even know why people are worried about whether the copyright is being infringed. The article is harmless. Good photo by the way.
  • Keep They aren't doughnuts, everyone in Canada knows of them.
  • Keep. I learn something on Wikipedia every day. Jacqui ★ 06:27, 8 November 2005 (UTC)
  • Tim Hortons has such a central place in Canadian culture that "Timbits" has become the generic term for these in Canada no matter what doughnut chain they're actually purchased from. Have to vote keep here. Bearcat 07:32, 8 November 2005 (UTC)
  • keep. DS 20:20, 8 November 2005 (UTC)
  • Keep. But change this statement, "sold at the Canadian Tim Hortons restaurant chain." TH was bought by Americans a long time ago. They are owned by Wendy's now. --maclean25 00:22, 9 November 2005 (UTC)
    • This is a semantic issue more than anything else; the chain is American-owned, but more than 90 per cent of its franchise locations are still in Canada. "Canadian chain" can legitimately refer to either ownership or where the actual stores are located. Bearcat 07:28, 9 November 2005 (UTC)
      • Indeed, it is an issue of semantics. The opening paragraph, especially the first sentence, needs to be absolutely clear and precise. It should not be open for interpretation. It should mean exactly what it says and say exactly what it wants to mean. It says "sold at the Canadian Tim Hortons"...so it isn't sold at American locations? or is the company Canadian? --maclean25 05:29, 10 November 2005 (UTC)
  • Keep --Romeo Bravo =/\= 05:19, 9 November 2005 (UTC)
  • Keep -- Just because it's trademarked doesn't mean it isn't a Canadian pop culture icon. If Americans can have apple pie, then we can have timbits. Skeezix1000 16:56, 9 November 2005 (UTC)
  • Keep, for reasons stated above. --TCM (Talk) 22:03, 9 November 2005 (UTC)
  • Keep There are plenty of similar types of entries. Let Canada keep what culture it has :) --Aaron Lees 08:08, 10 November 2005 (UTC)
  • Keep, because they are an institution. Carolynparrishfan 13:54, 10 November 2005 (UTC)
  • Keep, one of the few elements of Canadian culture - Tim Hortons and Timbits come right behind hockey. Plus, they're not doughnuts.
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was No consensus. Physchim62 (talk) 14:42, 13 November 2005 (UTC)

[edit] Timeline skew theories for The West Wing

Delete. First it was removed (by me) twice from the 2006 election page (West Wing Theory, an ironic name, being its only pusher)[41][42], was then split from the main West Wing article[43]. It is complete fancruft, spending an entire article discussing another magazine article and then flying off the handle with half-facts and completely original theories with no back-up in the show (the definition of fancruft and original research, as I understand them). Wikipedia is not a publisher of original thought. Staxringold 06:01, 7 November 2005 (UTC)

Keep. Whoa, this information was all forked from The West Wing where it had been for a very long time. The issue of what happened to shift the timeline in the show is a large one. A large portion of this article was built from an article appearing in a British television magazine, TV Zone. The fact that this theory is news-worthy, according to WP:No original research, makes it a valid encyclopedia article. I do not deny that there are some issues with the article, but I think that it should be the subject of a clean-up and not the subject of an AfD. -Scm83x 06:58, 7 November 2005 (UTC)

Response to merge suggestions. In response to those who have said to merge, I want to point out what ESkog mentioned. This article was already forked from The West Wing main article. If we re-merge it, we will create a huge file again. The fact that people suggest the merge suggest that it is valid content, but the merge suggestion overlooks the history of the article's content. -Scm83x 21:28, 7 November 2005 (UTC)

Delete. Very interesting material, but I'm having trouble seeing it as part of Wikipedia. Not all magazine articles qualify as news. Mentioning the sloppy writing and consequent inconsistent timeline on the West Wing page seems more appropriate to me. --William Pietri 07:36, 7 November 2005 (UTC)

  • Keep and clean up. There are other articles on similar TV-show based theories (I forget the name of it now, but there's the one connected with St. Elsewhere, for example). The citing of a magazine article, plus use of examples from the show itself, removes it from the original thought criteria, IMO. 23skidoo 13:09, 7 November 2005 (UTC)
  • Delete - Various magazines publish speculation and nitpicking about various TV series all the time for various reasons. They do not need separate articles. - Skysmith 15:13, 7 November 2005 (UTC)
  • Delete. It's not real. Monicasdude 17:56, 7 November 2005 (UTC)
  • Delete. Fiction. Would make a nice entry in a West Wing website... but Wikipedia is not a West Wing website. ➨ ❝REDVERS❞ 20:15, 7 November 2005 (UTC)
  • Keep and clean. It's not original research, per 23skidoo and Scm83x. It's forked from The West Wing due to the length of the main article. ESkog | Talk 20:56, 7 November 2005 (UTC)
  • Delete, Fancruft. At best a candidate for a merge into the main article on the show.--Isotope23 21:05, 7 November 2005 (UTC)

Response to merge suggestions. In response to those who have said to merge, I want to point out what ESkog mentioned. This article was already forked from The West Wing main article. If we re-merge it, we will create a huge file again. -Scm83x 21:28, 7 November 2005 (UTC)

Comment. I think a deleting this article and retooling the mention in the main article should suffice. The main theory of the one magazine article, that the 25th wasn't passed when it was in reality, is disproved almost immediately afterwards in the Time Skew article, so suggesting that that article makes the article valid is silly, as it is almost immediately set aside in exchange for fancruft theories. Staxringold 23:20, 7 November 2005 (UTC)
  • Delete Speculation about a TV show. Not a valid encyclopedia article. Some mention of this can be put in the main The West Wing (television) article, but it doesn't need its own page. --JW1805 23:23, 7 November 2005 (UTC)
  • Delete Do we really need all this silly speculation about a TV show? I am a West Wing fan, but come on, it's fiction! - Dalbury (talk) 00:19, 8 November 2005 (UTC)
  • Keep. Fancruft is what wikipedia is all about. Or at least, partially about. As Scm notes, discussion of canon in various fictional universes is a common topic in wikipedia. I don't see why this ought to be deleted. john k 07:07, 8 November 2005 (UTC)
    • The notion that cruft justifies more cruft is abhorrent to me; it seems like a very slippery slope. Is there a line you'd draw, or do you feel that all fans of anything deserve space for things like this on Wikipedia? --William Pietri 18:25, 8 November 2005 (UTC)
      • I was being somewhat facetious. I do, though, think it's generally unfair if there's a long-standing section in an article which gets too long, and is split off into its own article, which then gets deleted as fancruft. It is to be added that this issue is far more central, I think, to the constructed universe of The West Wing than, say, the Endor Holocaust is to the Star Wars universe. john k 18:53, 8 November 2005 (UTC)
  • Keep and Clean. The article is of interest to certain readers of Wikipedia, generally West Wing fans, so the material is germane since the show has a large number of related articles. Given the potential size of this article, it should be its own separate entry. It does need to be cleaned up to the point where it appears as its own entry rather than a sub-entry, but that's all that it needs. -Keillan 17:11, 8 November 2005 (UTC)
  • Comment: A potential idea. Perhaps, instead of an article entirely devoted to timeline skew theories, we could create an article on what is known about the fictional alternative history of the show and the ways it deviates from actual history, which would include a discussion of the timeline skew issue. That way the timeline skew issue wouldn't get a whole article devoted to it, but it wouldn't all have to go in the general West Wing article. john k 18:58, 8 November 2005 (UTC)
  • Comment about the previous comment. "The West Wing" is fiction, and fiction that isn't terribly careful about internal or external consistency on non-central points. For example, in the current West Wing universe, the Secret Service isn't providing (visible) protection for Santos and Vinick. Should I revise the timeline skew article to suggest that RFK wasn't assassinated, or Wallace wasn't shot? Maybe the timeline skew goes back much further -- there is, after all, no country called "Qumar" (or whatever) in the here and now. For it to exist, we pretty much have to go back and change Middle Eastern history in the aftermath of World War I. The whole timeline skew morass rests on a single comment about "2002" in a single episode, and all that the real "evidence" suggests is that an actor had a slip of the tongue, or that a writer made a minor mistake. Where does this sort of babbling stop? (Semi)-scientific speculation about how side effects of a nuclear power plant keeps the characters in the Simpsons from aging? Speculation about the continuity in the comic strip B.C. and how its characters appear to know about contemporary social issues (and how characters in the B.C. period know about events reported on or about 33 A.D.)? What kind of scientific advances have been made in the CSI universe to enable them to conduct DNA analyses in only a few hours, when in the here and now the tests take much longer? In the Disney universe, why has Goofy (a dog) had a pet dog of his own (Pluto)? (And why has ownership of Pluto changed so much, anyway?) Fiction is less consistent than reality, and Wikipedia shouldn't pretend otherwise. Monicasdude 19:59, 8 November 2005 (UTC)
  • Comment The Secret Service is giving both candidates coverage. That would be why there are all the tall, silent men in black suits in the rest room with Vinick when Frost briefs him, why there are tall, silent men in black suits all standing around at the Al Smith dinner, etc. Staxringold 00:33, 9 November 2005 (UTC)
one more Comment. But not consistently enough. Remember in particular the scene where the two candidates meet in an apparently unsecured kitchen at the Al Smith dinner. It's a budget thing; in scenes calling for extras, a few are playing agents. But in other scenes, they're not to be seen. You're right that I wasn't clear enough, though, I should have said (consistent) rather than (visible). Monicasdude 01:44, 9 November 2005 (UTC)
But you aren't listening. There were agents in the kitchen, not to mention that President's often have to come in through kitchens (we've seen Bartlet do it before). Staxringold 11:13, 9 November 2005 (UTC)
  • Keep, mostly because I'm reluctant to outright delete content that was forked due to article length. This needs a rewrite by someone familiar with the series to correct for structural issues (move the discussion of timeline differences above the theories, etc.), and it could probably use a more intuitive title as well (Irregular Timeline in The West Wing?). -Colin Kimbrell 17:29, 10 November 2005 (UTC)
Comment When I forked the article, I had trouble coming up with a name for it. I tried for the most intuitive thing I could, but I forgot that in addition to the theories, it is also a discussion of the differences. I agree that the name change is necessary. That, however, is an issue for after the AfD. -Scm83x 19:51, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was delete.  Denelson83  04:50, 12 November 2005 (UTC)

[edit] TLME

Nonsense. Thomas loves Miss Edgley; so what? Delete. Paolo Liberatore (Talk) 21:13, 7 November 2005 (UTC)

  • What's wrong with a little frivolity? If, indeed, "so what", why does it need to be deleted? —Preceding unsigned comment added by Poorsod (talk • contribs) 21:51, 7 November 2005
  • Because this is an encyclopedia. Delete as non-topic. Punkmorten 22:09, 7 November 2005 (UTC)
  • Delete and speedy as nonsense if possible. Just zis Guy, you know? [T]/[C] :: AfD? 22:16, 7 November 2005 (UTC)
  • I do believe a careful reading of WP:CSD would support speedy deletion under criteria G3, A1, A7 and possibly A6. Probably not quite A3, though it does come close. —Ilmari Karonen (talk) 23:34, 7 November 2005 (UTC)
  • Speedy Delete under various categories outlined by Ilmari Karonen. Capitalistroadster 00:25, 8 November 2005 (UTC)
  • Speedy Delete patent nonsense --Rogerd 03:09, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Speedy delete (A2). Physchim62 (talk) 14:45, 13 November 2005 (UTC)

[edit] Tomato Pie

Has been transwikied, no encyclopaedic content. Ingoolemo talk 08:09, 7 November 2005 (UTC)

  • Merge and redirect to pizza unless a native of the area mentioned in the article can explain why it is different from a pizza, which the article currently does not achieve. Jacqui ★ 06:30, 8 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was no consensus. Robert T | @ | C 02:57, 13 November 2005 (UTC)

[edit] UQ Union

delete page as WP not a collection of university union members. Brief reference to student union's existence can easily be covered in universtiy article page.—Gaff ταλκ 07:10, 7 November 2005 (UTC)

  • Delete for unencyclopaedic content. Ingoolemo talk 07:31, 7 November 2005 (UTC)Keep much better now. Ingoolemo talk 22:04, 8 November 2005 (UTC)
  • Delete per nominator. *drew 07:32, 7 November 2005 (UTC)
  • Keep. The article needs to be improved but the topic matter is distict enough to require a seperate article. Whether or not a particular article is unencyclopaedic is often subjective. Robertbrockway 08:50, 7 November 2005 (UTC)
  • Delete per nom. *sigh* The UQ Union has probably wasted part of my $132 yet again, this time by paying someone to put this (and other) non-encyclopædic garbage in Wikipedia. They have their own damned webpage, so they can keep it all there. -LichYoshi 11:58, 7 November 2005 (UTC)
  • Delete wholly unencyclopedic, nn. Dottore So 12:00, 7 November 2005 (UTC)
  • Delete per nominator. -- stillnotelf has a talk page 13:43, 7 November 2005 (UTC)
  • Redirect to University_of_Queensland#UQ_Union. There is more relevant detail in the section of the University of Queensland article than in this article. The executive is transient information. Capitalistroadster 22:45, 7 November 2005 (UTC)
  • Delete, these details aren't useful for an encyclopedia.--nixie 23:15, 7 November 2005 (UTC)
  • Redirect per Capitalistroadster, for now; this should not preclude the creation of an encyclopaedic article on the union itself later on should anyone actually get off their arses and write one. ～J.K. 23:22, 7 November 2005 (UTC)
Keep. Ambi just did. ～J.K. 10:20, 8 November 2005 (UTC)
  • Note: This debate has been included in the list of Australia-related deletions. .Capitalistroadster 00:20, 8 November 2005 (UTC)
  • Strong keep. Entirely encyclopedic topic. Ambi 01:06, 8 November 2005 (UTC)
  • Note: I've just rewritten the article entirely from scratch. The previous content was so execrable it could probably have been speedied, but I hope that this will suffice now. Ambi 01:40, 8 November 2005 (UTC)
  • Strongly urge to keep. This post is entirely related, especially since its renovation. As a first time user, I prematurely published this article by accident, mistakenly thinking I was within the safe confines of sandbox. Wikimedia surpasses academic edited collections because it can bring the ‘niche’ as well as the ‘general’, this is just as relevant as comments about pages about state politicians in QLD, or young Labor factions. I am not associated with the Union and certainly not paid. I have no reason to believe that anything suggests that this is affiliated with the official website. That comment is completely unfounded, unsubstantiated statement. This page is relevant to the VSU debate. It can be redirected from Australian Student Unions or NUS or UQ. User: China doll gloss 19:57, 8 November 2005 (UTC)
  • Keep. Maybe we can stop deletion of University Unions now.--Nicodemus75 12:30, 8 November 2005 (UTC)
  • Keep, following User:ambi's rewrite.fuddlemark (fuddle me!) 12:32, 8 November 2005 (UTC)
  • Keep - encyclopaedic, verifiable article (ext. link included) -- Ian ≡ talk 01:55, 9 November 2005 (UTC)
  • Keep, following Ambi's rewrite. -- Adz 04:45, 12 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 02:54, 13 November 2005 (UTC)

[edit] Wahey

Useless neologism. Delete, possibly a candidate for speedy deletion. - Mike Rosoft 19:31, 7 November 2005 (UTC)

  • Delete nonsense. Paolo Liberatore (Talk) 20:04, 7 November 2005 (UTC)
  • Delete Word exists, definition is complete bollocks. And even if it wasn't it's a dicdef. Just zis Guy, you know? [T]/[C] :: AfD? 22:42, 7 November 2005 (UTC)
  • Delete per nom --Rogerd 03:34, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 02:53, 13 November 2005 (UTC)

[edit] WatchMePaint.com

Article is nothing but an advertisment for a web site with no Alexa ranking-- GraemeL (talk) 21:07, 7 November 2005 (UTC)

  • Delete nn website spam, and burn all adverts. Just zis Guy, you know? [T]/[C] :: AfD? 22:09, 7 November 2005 (UTC)
  • Delete Advertising. *drew 01:08, 8 November 2005 (UTC)
  • Delete advert --Rogerd 03:06, 10 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was DELETE. Robert T | @ | C 02:52, 13 November 2005 (UTC)

[edit] Wiki wank

Delete Neologism Krzypntbllr 23:38, 6 November 2005 (UTC)

  • Delete per nom. --Fire Star 23:45, 6 November 2005 (UTC)
  • Delete, neologism. 70.122.87.59 23:47, 6 November 2005 (UTC)
  • Delete as per nom abakharev 06:23, 7 November 2005 (UTC)
  • This afd nomination was orphaned. Listing now. —Crypticbot (operator) 12:26, 7 November 2005 (UTC)
  • Delete Per Nomination. --Robby 15:50, 7 November 2005 (UTC)
  • Delete per nom. BrianSmithson 18:31, 7 November 2005 (UTC)
  • Delete neologism JFW | T@lk 01:36, 8 November 2005 (UTC)
  • Delete per nominator. —Cleared as filed. 23:16, 11 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.
The following discussion is an archived debate of the proposed deletion of the article below. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.

The result of the debate was Keep. Hedley 03:37, 13 November 2005 (UTC)

[edit] Yandex

Delete? This looks like it might potentially be a stub to something in Russian based on Google. But not sure and there are prior deleted articles listed as "spam." Thus listing here to establish some consensus.—Gaff ταλκ 05:31, 7 November 2005 (UTC)

  • Keep at alexa rank of 208, it seems notable. I have removed some POV from it (not much left). Paolo Liberatore (Talk) 19:26, 7 November 2005 (UTC)
  • Keep. In my limited exploration of the Russian part of the Internet, I have seen Yandex mentioned several times. The much smaller Russian Wikipedia also has an article under Яндекс. --Joel7687 23:52, 7 November 2005 (UTC)
The above discussion is preserved as an archive of the debate. Please do not modify it. Subsequent comments should be made on the appropriate discussion page (such as the article's talk page or in a deletion review). No further edits should be made to this page.