Haplogroup Q (Y-DNA)

From Wikipedia, the free encyclopedia

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Human Y-chromosome DNA (Y-DNA) haplogroups

Y-most recent common ancestor

|

A

|

B

|

C

DE

F

D

E

G

H

IJ

K

I

J

L

M

NO

P

N

O

Q

R

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.

This haplogroup contains the patrilineal ancestors of many Siberians and (through its subgroup Q3) almost all of the indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.^[1] This haplogroup is surprisingly diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

The initial migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations, approximately 15,000 years ago. This founding population spread throughout the Americas.

Once in the Americas, haplogroup Q underwent a mutation, producing its descendant haplogroup Q3 (M3), which is the most common Y-chromosome haplogroup among the indigenous peoples of the Americas.

Contents 1 Technical specification of mutation 2 Subgroups 3 References 4 External links

[edit] Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc

[edit] Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2006 ISOGG tree:

• Q (MEH2, M242, P36)
  • Q*
  • Q1 (M120, N14 (M265)) Found at a low frequency among Chinese, Koreans, Dungans, and Hazara^[2][3]
    • Q1*
    • Q1a (M378) Reported to occur at a low frequency among samples of Hazara and Sindhis
  • Q2 (M25, M143) Found at low to moderate frequency among populations of Central Asia and Siberia
  • Q3 (M3) Typical of indigenous peoples of the Americas
    • Q3*
    • Q3a (M19) Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu^[4]
    • Q3b (M194)
    • Q3c (M199)
  • Q4 (P48)
  • Q5 (M323) Found in a significant minority of Yemeni Jews
  • Q6 (M346) Found at a low frequency in Pakistan and India

[edit] References

1. ^ High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, Stephen L. Zegura, Tatiana M. Karafet et al., 2003
2. ^ Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture," Nature 431, 302-305 (16 September 2004)
3. ^ Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
4. ^ "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas," Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003

[edit] External links

• Q Y-Haplogroup project at FTDNA
• American Indian Q3 project at FTDNA
• Spread of Haplogroup Q, from The Genographic Project, National Geographic

• The India Genealogical DNA Project