Telomere

From Wikipedia, the free encyclopedia

You have new messages (last change).

A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear eukaryotic chromosomes are replicated during late S-phase the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell's activities. Every time a cell with linear genes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James Watson and Alexei Olovnikov as the "end replication problem" (1971).

Contents

[edit] Nature and function of telomeres

In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

The telomere is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2.

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

[edit] Telomere shortening

Lagging strand during DNA replication
Enlarge
Lagging strand during DNA replication

"Telomeres" shorten because of the lagging strand phenomenon that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 3' to 5' direction (polymerizing in the 5'-3' direction) one finds, on the DNA molecule being replicated, a leading and lagging strand.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 3' to 5'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication.

[edit] Extending telomeres

The phenomenon of limited cellular division was first observed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco. In 1998, Geron Corporation developed techniques for extending telomeres, and proved that they prevented cellular senescence.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans. In 2006, Geron corporation's web site indicated that it had at least two candidate drugs able to activate telomerase. [1]

However, it has been hypothesized that there is a tradeoff between cancerous tumor suppression and tissue repair capacity, and that by lengthening telomeres we might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced and, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004).

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds:

In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres[2]. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed, and more research into the topic is clearly warranted before any firm conclusions can be drawn or even practical applications tested.

[edit] Telomere Length Assay

Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. These impedements have been overcome with a novel Real-Time PCR assay for telomere length developed by Richard Cawthon at the University of Utah. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demostrated to be proportional to the average telomere length in a cell (Cawthon 2002). The Real-Time PCR assay has been since redeveloped in a high-throughput 384-well format for use with an Applied Biosystems 7900HT by Jason Wong of the Brigham and Women's Hospital / Harvard Medical School; making the assay feasible for use in large cohort studies.

[edit] Telomere sequences

Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungii Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

[edit] Telomeres and cancer

Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

[edit] References

  • Joeng KS, Song EJ, Lee KJ, Lee J (2004). "Long lifespan in worms with long telomeric DNA". Nature Genetics 36 (6): 607-11. PMID 15122256.
  • Juola, Frans A.; Haussmann, Mark F.; Dearborn, Donald C.; Vlek, Carol M. (2006): Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool. Auk 123(3): 775–783. DIO: 10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2 HTML abstract

[edit] Related papers

[edit] External links

Retrieved from "http://en.wikipedia.org../../../t/e/l/Telomere.html"