User talk:Sakurambo

From Wikipedia, the free encyclopedia

Welcome!

Hello, Sakurambo, and welcome to Wikipedia! Thank you for your contributions. I hope you like the place and decide to stay. Here are a few good links for newcomers:

I hope you enjoy editing here and being a Wikipedian! Please sign your name on talk pages using four tildes (~~~~); this will automatically produce your name and the date. If you need help, check out Wikipedia:Questions, ask me on my talk page, or place {{helpme}} on your talk page and someone will show up shortly to answer your questions. Again, welcome!  —Khoikhoi 19:34, 26 April 2006 (UTC)

Hi and welcome to wikipedia. While I understand the tendency for newbies to want to be helpful, simply deleting articles which should instead simply redirect (to Romaji, etc.) is not one of the best ways. Please understand that WP has long used redirects for common mispellings of words. They help boost our relevance in searches, and get people to where they want to go. Regards, and again, welcome! -Ste|vertigo 19:31, 15 May 2006 (UTC)
You're suggesting that Wikipedia should contain false information in order to perform well in searches for non-existent words. I haven't seen anything in the style manual to support this view. I'm sure redirects are useful for alternative spellings (like ColourColor) and equivalent terms (like RomajiRomanization of Japanese), but if redirects are also used for spellings that are just plain wrong, then people are going to be misled.
If your redirect at Romanji stays in, people will assume this word actually exists instead of checking for themselves. This misinformation has already propagated to the articles Chatan, Okinawa, Hepburn romanization, Angelic Layer, Kagerou (band), Astranagant, Dance Dance Revolution 5thMIX, Ai no Dai 6 Kan, Gakuen Heaven, Kana, Richard Vallance, THE FINAL, Romanization of Japanese, and even Template:Nihongo, not to mention dozens of "Talk" pages. -- Sakurambo 21:59, 15 May 2006 (UTC)
How else are people who dont know the "proper" spelling of something going to find the proper spelling? Could you for example type something like Brzezinski just off the top of your head? -Ste|vertigo 04:06, 16 May 2006 (UTC)
Brzezinski and Brzeziński are both valid spellings of the name. One redirects to the other. There are currently no other redirects to either of these articles, misspelt or otherwise. Please explain how this supports your case for adding non-words to Wikipedia. -- Sakurambo 08:39, 16 May 2006 (UTC)
As someone whos been tinkering around for at least a couple months now, I can tell you that using redirects from misspellings is not improper, provided the mispellings are corrected in the article. They pick up search engine traffic and thats good for us. Thats how WP got to where it is, by helping people get from one place to antother and centralizing data and the debate surrounding that data.
I agree the current redirect system is not ideal, and that your concern in particular that using such leads to misuse or even disharmony (gasp!) between terms. But its a bit more complex than that, and any changes which you suggest need to be dealt with at wikien, where our philosophers and meta-encyclopedists can deal with it more correctly - even proposing software changes if necessary. Myself, I would prefer that we had a more astracted and powerful access and editing for redirects from the what links here page. Regards -Ste|vertigo 18:31, 16 May 2006 (UTC)
OK, you were right. I've just discovered there's a whole category specifically devoted to redirects from misspellings, so obviously this is something that happens a lot. But it is rather unfortunate that the user sees no indication of this status in the target page. I suppose it's obvious enough when the target page is titled with the correct spelling (e.g. protien→protein), but when it has a completely different wording (like Romanji→Romanization of Japanese) then the user is far less likely to notice the error.
Like you said, this is something for the developers to work on. Thanks for being patient. -- Sakurambo 17:49, 17 May 2006 (UTC)

Contents

[edit] Copyright problems

I just thought I'd point out that Chubb illusion is a verbatim copy of a copyrighted article at the Center for Cognitive Neuroscience at Duke University. I don't want to wind up the admins again, so if you think this needs fixing, please do it yourself. -- Sakurambo 09:55, 19 May 2006 (UTC)

I'll look into it, starting with talking to the original editor.--Commander Keane 10:15, 19 May 2006 (UTC)

[edit] pretty pictures

You made a very nice illustration for pseudoknot not too long ago, and I was wondering if you might make a similar one for stem-loop, which is basically half a pseudoknot. As you probably know, it looks like this (ugh, ascii art):

  _
 | |
|   |
|   |
 |-|
 |-|
 |-|
 |-|

Example sequence (made up, but realistic):

ACGUGCCACGAUUCAACGUGGCACAG
--((((((((------))))))))--

Thanks! Opabinia regalis 06:31, 27 May 2006 (UTC)

You're awesome, thanks! Opabinia regalis 09:44, 27 May 2006 (UTC)


[edit] Kiss-Me Kimi Ga Yo

I want to know that who made this lyric and who want to spread it.--TOMATOBOMB 02:29, 16 June 2006 (UTC)

Vandalizing pages is not a very good way of making a point. Why not discuss this in the Kimi Ga Yo talk page where you deleted this text from? -- Sakurambo 02:38, 16 June 2006 (UTC)
Answer my question with a reliable source. Why you can't consider that your act will give a reason to many Japanese promoting the right wing? Your act is childish but it is not forgiven as only children's mischief.--TOMATOBOMB 09:24, 17 June 2006 (UTC)
If you had bothered to look at the Talk:Kimi Ga Yo page and read my notes there, you might have noticed that this story has been published by news agencies in Japan and other countries. If you care to use a search engine you'll find lots of other references on the web. Just what is your problem exactly? Sakurambo 22:20, 17 June 2006 (UTC)
Your suggested page not be the answer to my question. Those articles are a mere conjecture and there is no concretely things. And google results too. Only I can know that this parody lyrics were tried to spread by anonymous, but in vain now. Because if their propose were success, it become more big news in Japan. I don't think that it is necessary description in the article of "kimi-ga-yo". I don't understand what your purpose is or what you want, but if you want to up this incident to Wikipedia, Anti-Japanese sentiment is more proper than "kimi-Ga-yo".--TOMATOBOMB 08:17, 18 June 2006 (UTC)
I disagree. The lyrics are related to Kimi Ga Yo and it is right to mention them in the Kimi Ga Yo article in just the same way that God Save the Queen (Sex Pistols song) is mentioned in the God Save The Queen article. The articles about the "Kiss Me" lyrics are attributed to Reuters and the Kyodo News Agency. Are you suggesting that these news agencies are unreliable sources? That is an absurd assertion. -- Sakurambo 09:45, 18 June 2006 (UTC)
I don't say that Kyodo News Agency is not reliable. But Who made this lyric? Who want to spread it? What is their propose?Those news not be the answer. Ofcouse it is as news there are somehow value itself, but wikipedia is encyclopedia. this parody lyrics is too little information to up to wikipedia.
And the God Save the Queen (Sex Pistols song) is not described all lyric nor mentioned it's mean in the God Save the Queen article. furthermore Sex Pistols is famous all over the world. Your opinion is unbalance.--TOMATOBOMB 13:48, 18 June 2006 (UTC)
You know perfectly well that the author of the lyrics is unknown. That has absolutely no bearing on the value of this story with regard to inclusion in Wikipedia. You can answer all your other qustions by yourself. Just follow some of the links I gave you and read the articles for yourself. I suggest you also read WP:NPOV (or ja:WP:NPOV if you prefer).
NPOV? It's another problem NPOV or POV.
I say that this parody lyric's background is not clear, as you agree too. And according from you suggested articles, there are some political intention to want to spread this lyric, it is natural we must know who made this lyric to describe this incident.--TOMATOBOMB 16:02, 21 June 2006 (UTC)
Troll Warning

Since you are clearly trolling and have no interest in holding a sensible discussion, it would be a waste of time to continue responding to your messages. Please go away. -- Sakurambo 16:57, 21 June 2006 (UTC)

Do you blame me because you can't answer my questions? Worse still you are pushing your opinion without an understandable objection, aren't you? Do you think that is right?--TOMATOBOMB 15:37, 23 June 2006 (UTC)

[edit] Wikipedia:Suspected sock puppets/TOMATOBOMB

Hello. I am glad to say that the case has quickly been closed, and that the IP he was using has been blocked, though not indefinitely becuase of the WP:BP. I have not blocked Tomatobomb, but simply warned him about using other IP addresses. If you need further information on the matter, or would like to ask a question or whatever, feel free to contact me on my talk page. Iolakana|(talk) 19:10, 23 June 2006 (UTC)

[edit] Laurence-Moon syndrome and Bardet-Beidl syndrome

Sakurambo-san,

I have added an answer to your question posted in May at Talk:Laurence-Moon syndrome. I hope you find it somewhat helpful. N2e 19:09, 24 June 2006 (UTC)

Here is a great new reference I found today re Laurence-Moon syndrome. Quotes a 2005 paper so it is much newer research. Paper 245800 on LAURENCE-MOON SYNDROME
I will let you choose how you might want to integrate any of this info into the LMS article. Enjoy. N2e 03:41, 26 June 2006 (UTC)
Wow. I just realized that the reason I was able to read this paper today is that someone put the link to that paper onto the LMS WP page. They did not however summarize the significant findings in an enclyclopedic way, nor even properly title the link. So that work remains. But they made a great contribution. Isn't the spontaneous order of Wikipedia wonderful? N2e 04:31, 26 June 2006 (UTC)

[edit] Re Daisy, Daisy

Hi there. All I can recall about the article is that it was in New Scientist magazine, quite a long time ago now (1988 IIRC). Admittedly computers were a lot less sophisticated then than they are now, so modern machines may not behave in the same way. Regards Martyn Smith 18:36, 4 July 2006 (UTC)

[edit] Warning of Personal Attack on me

Please do not make personal attacks on other people. Wikipedia has a policy against personal attacks. In some cases, users who engage in personal attacks may be blocked from editing by admins or banned by the arbitration committee. Comment on content, not on other contributors or people. Please resolve disputes appropriately. Thank you. --Questionfromjapan 10:31, 22 July 2006 (UTC)

[edit] Kimi Ga Yo

See the note.and don't paste your terrible Japanese corrupt sentence directly.Think TPO.It is OK when you speak with your native friends,but I think your native friend cannot say your corruption.but It is bad when you write such a political article.write note your sentence before you write your sentence directly in article.I might help you by some possibility.--Forestfarmer 12:49, 28 July 2006 (UTC)

Pardon?? Sakurambo 桜ん坊 19:14, 28 July 2006 (UTC)
I didn't delete it because I am disagree it, but because it is not the truth. I don't oppose to write the content if it was truth. But to tell the truth I don't know any type of parody of Kimi ga Yo, whereas I know the song is contestable. If you want to write the content, you mustn't misrepresent the facts of the content.Mythologia 21:56, 30 July 2006 (UTC)

[edit] Baker & McKenzie

Philip: I do not understand how NPOV supports your deletion of the edits I made to the Baker & McKenzie page. My edits were to: (1) add the name "John McKenzie" as the co-founder of the firm, which should be clear from the firm's name and is a true fact; and (2) to update the hyperlink to the current Hoover's Company URL for this firm instead of the previous link to a six year old historic Hoover's Company URL archived at the University of Illinois. I used text from Hoover's 2006 information to replace the "McFirm" reference taken from the 2000 article. If anything, the current text represents a non-neutral point of view. I am not trying to re-write history and did not try to remove any of the other arguably biased text (i.e., positive references to the firm as dismissed as "claims"). Nor did I try to add any positive "in the News" items, even though the three stories cited are all negative. Yes, I do work there and, no, I do not think the firm is perfect, but Wikipedia is supposed to be a reliable source of information and not a rant. C. Matthew Schulz 01:07, 23 August 2006 (UTC)

[edit] Image:Western isles.gif

Someone else changed it to icon, I had it as logo (it's really obviously a flag, but one associated with an athletic competition). It's from [1]. You can also see it at FOTW at [2]. I've been planning on making an SVG version of it, but haven't yet gotten around to it. Hopefully a fair use rationale can be made for its use as an icon depicting the Western Isles in Island Games sporting events. If not, no biggie. OzLawyer / talk 13:52, 29 November 2006 (UTC)

[edit] Did you know?

Updated DYK query On 6 December 2006, Did you know? was updated with a fact from the article Kenjiro Takayanagi, which you created. If you know of another interesting fact from a recently created article, then please suggest it on the "Did you know?" talk page.

--GeeJo (t)(c) • 15:32, 6 December 2006 (UTC)

Fame at last!! :-D -- Sakurambo 桜ん坊 17:02, 6 December 2006 (UTC)


[edit] Much Appreciated


A child laughing

Thank you so much for the tip regarding using the preview button for my recent contributions to laughter. Indeed, those bots can be quick. TESCHD 16:07, 8 December 2006 (UTC)